All Activity
This stream auto-updates
- Past hour
-
Is the US government actively trying to make the Sasquatch race extinct?
hiflier replied to RedHawk454's topic in General Bigfoot Discussion
Bold statement but since what she did is held up as a smoke screen to distract from the raw science her shenanigans will always be spotlighted at center stage to discourage anyone from doing an in-depth study of the SCIENTIFIC results. Following close on the heels of that argument is the fact that as far as I know there has been no raw data provided for the e-DNA nest soil sample results. So we are to just take the word of Dr. Meldrum and Dr. Disotell on those results? Without a white paper? With the Sasquatch Genome Project we have a TON of raw data. As far as raw data from the Olympic Peninsula nest samples (only 5?) we have.........nothing. And I guess we're simply supposed to accept that? No mtDNA even? No word about who was filtered out from the DNA equation? The samples had Human DNA so why don't I hear people screaming "contaminated? on that and slamming those results? -
Is the US government actively trying to make the Sasquatch race extinct?
Huntster replied to RedHawk454's topic in General Bigfoot Discussion
I agree 110%. Moreover, had her study, interpretation, and behavior been absolutely perfect, she'd still get slammed. That's just the way it is and the way it's going to be. -
Is the US government actively trying to make the Sasquatch race extinct?
hiflier replied to RedHawk454's topic in General Bigfoot Discussion
There is raw data. RAW DATA. It came from twelve unconnected, independent labs in a double-blind study and that study is what produced the raw data. Dr. Melba Ketchum interpreted that raw data. She got slammed and to this day still gets slammed because she tainted her interpretation of the raw data through her own personal belief system. Personally I don't care about what she said or even says today. I stay with the science and the science is in the raw data regardless of anyone's personal spin on it. I would like more independent experts to look at the data. Now I'm sure that that has happened but I am also sure that the PUBLIC summaries of any experts is weight against career choices but I STILL would like to find someone who would look ALL of the raw data who knows what they're doing. -
Is the US government actively trying to make the Sasquatch race extinct?
Huntster replied to RedHawk454's topic in General Bigfoot Discussion
Their only predators are orcas and man, both of whom are not common in the Arctic Ocean, especially prior to the 20th Century. They became nearly completely protected worldwide by the mid-1970's, and orca numbers worldwide were down by that time too because of whaling (they also became almost completely protected). The only legal polar bear hunting is in Canada, where their densities are highest, and the harvest is very low. A polar bear hunt will cost you > $60K there. Now polar bear numbers are higher than ever, but like usual, preservationalists are never satisfied. Any talk of limited harvest to keep populations at a scientific ideal is attacked rabidly. And of course, they now have this climate change silliness to use to broadcast their stupidity. Ideally, they'd visit Barrow, drive out to the whale boneyard, get out if their vehicle to take pictures, and end up as hor d'oeuvres......... Only for the Clown Corps. Her study fits quite well with Sykes Zana study. - Today
-
Bobcats and foxes make some freaky sounds could it have been this maybe
-
He told me about a week after the fact and now that you mention it we never went and looked. He called it the NJ devil but never could see it bc of the darkness and was too scared to leave his house.
-
Is the US government actively trying to make the Sasquatch race extinct?
hiflier replied to RedHawk454's topic in General Bigfoot Discussion
I was joking of course. To tell you the truth I would like to get a professional's evaluation of this raw data: TCACTCCACCCCCACAGCCATCCCCCAGCTGGGGCTGGCTGCCAACCAGACAGGAGCCCGGTGCCTGGAGGTGTCCATCTCTGACGGGCTCTTCCTCAGCCTGGGGCTGGTGAGCTTGGTGGAGAACGCGCTGGTGGTGGCCACCATCGCCAAGAACCGGAACCTGCACTCACCCATGTACTGCTTCATCTGCTGCCTGGCCTTGTCGGACCTGCTGGTGAGCGGGAGCAACGTGCTGGAGACGGCCGTCATCCTCCTGCTGGAGGCCGGTGCACTGGTGGCCCGGGCTGCGGTGCTGCAGCAGCTGGACAATGTCATTGACGTGATCACCTGCAGCTCCATGCTGTCCAGCCTCTGCTTCCTGGGCGCCATCGCCGTGGACCGCTACATCTCCATCTTCTACGCACTGCGCTACCACAGCATCGTGACCCTGCCGCGGGCGCGGCGAGCCGTTGCGGCCATCTGGGTGGCCAGTGTCGTCTTCAGCACGCTCTTCATCGCCTACTACGACCACGTGGCCGTCCTGCTGTGCCTCGTGGTCTTCTTCCTGGCTATGCTGGTGCTCATGGCCGTGCTGTACGTCCACATGCTGGCCCGGGCCTGCCAGCACGCCCAGGGCATCGCCCGGCTCCACAAGAGGCAGCGCCCGGTCCACCAGGGCTTTGGCCTTAAAGGCGCTGTCACCCTCACCATCCTGCTGGGCATTTTCTTCCTCTGCTGGGGCCCCTTCTTCCTGCATCTCACACTCATCGTCCTCTGCCCCGAGCACCCCACGTGCGGCTGCATCTTCAAGAACTTCAACCTCTTTCTCGCCCTCATCATCTGC http://www.sasquatchgenomeproject.org/sasquatch_genome_project_003.htm -
Sure. There is no greater lack of fossil evidence from the New World than from the Old World. If we were to postulate new world monkey ancestors, then the apparent tapetum lucidum presence would no longer be out of place. I do not know if it is right or not but it seems an adequate and elegant solution. That being the case, it seems a mistake to dismiss it on mere beliefs not backed by evidence which is what has happened so far. MIB
-
Packing in by mule string! Very cool!
-
Is the US government actively trying to make the Sasquatch race extinct?
starchunk replied to RedHawk454's topic in General Bigfoot Discussion
Arent we at a point that anything to do with Melba Ketchum is just Comedy fodder -
Is the US government actively trying to make the Sasquatch race extinct?
hiflier replied to RedHawk454's topic in General Bigfoot Discussion
By comparison I will have to agree Unless the nests in the Olympic Peninsula were made by Unicorns even though there was no apparent Unicorn DNA noted in the samples Dr. Ketchum was a geneticist who dealt with thoroughbred horses however so maybe, just maybe.......NAAAAAAH! -
Is the US government actively trying to make the Sasquatch race extinct?
guyzonthropus replied to RedHawk454's topic in General Bigfoot Discussion
Hiflier I really doubt there would be a whole forum devoted to anything THAT strange! Lol But this is more mainstream that a lot of the stuff out there! -
Is the US government actively trying to make the Sasquatch race extinct?
hiflier replied to RedHawk454's topic in General Bigfoot Discussion
Are you kidding me? This whole subject is strange -
Or even a LOT
-
Is the US government actively trying to make the Sasquatch race extinct?
georgerm replied to RedHawk454's topic in General Bigfoot Discussion
This seems to be the case. I wish we could find a military guy that was present at the Mt. Saint Helens bigfoot cover up. The whole story is strange. Agree, and is there any proof? -
What did he find in the morning?
-
Hey, if folks can postulate telepathic, terrain- gliding woods-ninjas, I figure I'm granted a little leeway.
-
THAT would be a real eye opener.
- Yesterday
-
Perhaps another, completely unknown species, probably primate. New World origination
-
I don't understand...
-
My next door neighbor listened to a deer get torn apart in the middle of the night between our two houses. He described it as the most horrific thing he has ever listened to .
-
Hey Norse the location is in north eastern Tuolumne County Ca. I grew up there lived there my entire life. My dad lived there since the 1940’s. I learned the location from one from the Sardellas who own the pack station at Kennedy Meadows. That’s the where they were packed into the location from . My Dad and Joe Sardella are life long pals so he showed me the location one summer.
-
HawkEye joined the community
-
The case for Homo Erectus
BlackRockBigfoot replied to norseman's topic in General Bigfoot Discussion
I mentioned this in another thread recently. The preternatural speed and agility that is so often discussed in accounts does not seem to be found in video evidence. The only two videos that I can think of that show anything like that are the baby Bigfoot tree swinging video and one (from Russia I believe) that showed a primate basically smoothly moving through the underbrush at a high rate of speed. -
Here is a version of a much older video showing a BF running on all fours. I am sure somebody will post that is a a proven hoax but it sure looks good to me and has been in my top 10 BFs video list for a long time. https://sasquatchchronicles.com/forums/topic/bigfoot-chasing-on-all-fours-video/
-
^^ Umm, "the possibility of something like the De Loy's ape......."
