Jump to content

All Activity

This stream auto-updates     

  1. Past hour
  2. Their only predators are orcas and man, both of whom are not common in the Arctic Ocean, especially prior to the 20th Century. They became nearly completely protected worldwide by the mid-1970's, and orca numbers worldwide were down by that time too because of whaling (they also became almost completely protected). The only legal polar bear hunting is in Canada, where their densities are highest, and the harvest is very low. A polar bear hunt will cost you > $60K there. Now polar bear numbers are higher than ever, but like usual, preservationalists are never satisfied. Any talk of limited harvest to keep populations at a scientific ideal is attacked rabidly. And of course, they now have this climate change silliness to use to broadcast their stupidity. Ideally, they'd visit Barrow, drive out to the whale boneyard, get out if their vehicle to take pictures, and end up as hor d'oeuvres......... Only for the Clown Corps. Her study fits quite well with Sykes Zana study.
  3. 7.62

    The case for Homo Erectus

    Bobcats and foxes make some freaky sounds could it have been this maybe
  4. Today
  5. NCBFr

    The case for Homo Erectus

    He told me about a week after the fact and now that you mention it we never went and looked. He called it the NJ devil but never could see it bc of the darkness and was too scared to leave his house.
  6. I was joking of course. To tell you the truth I would like to get a professional's evaluation of this raw data: TCACTCCACCCCCACAGCCATCCCCCAGCTGGGGCTGGCTGCCAACCAGACAGGAGCCCGGTGCCTGGAGGTGTCCATCTCTGACGGGCTCTTCCTCAGCCTGGGGCTGGTGAGCTTGGTGGAGAACGCGCTGGTGGTGGCCACCATCGCCAAGAACCGGAACCTGCACTCACCCATGTACTGCTTCATCTGCTGCCTGGCCTTGTCGGACCTGCTGGTGAGCGGGAGCAACGTGCTGGAGACGGCCGTCATCCTCCTGCTGGAGGCCGGTGCACTGGTGGCCCGGGCTGCGGTGCTGCAGCAGCTGGACAATGTCATTGACGTGATCACCTGCAGCTCCATGCTGTCCAGCCTCTGCTTCCTGGGCGCCATCGCCGTGGACCGCTACATCTCCATCTTCTACGCACTGCGCTACCACAGCATCGTGACCCTGCCGCGGGCGCGGCGAGCCGTTGCGGCCATCTGGGTGGCCAGTGTCGTCTTCAGCACGCTCTTCATCGCCTACTACGACCACGTGGCCGTCCTGCTGTGCCTCGTGGTCTTCTTCCTGGCTATGCTGGTGCTCATGGCCGTGCTGTACGTCCACATGCTGGCCCGGGCCTGCCAGCACGCCCAGGGCATCGCCCGGCTCCACAAGAGGCAGCGCCCGGTCCACCAGGGCTTTGGCCTTAAAGGCGCTGTCACCCTCACCATCCTGCTGGGCATTTTCTTCCTCTGCTGGGGCCCCTTCTTCCTGCATCTCACACTCATCGTCCTCTGCCCCGAGCACCCCACGTGCGGCTGCATCTTCAAGAACTTCAACCTCTTTCTCGCCCTCATCATCTGC http://www.sasquatchgenomeproject.org/sasquatch_genome_project_003.htm
  7. MIB

    The case for Homo Erectus

    Sure. There is no greater lack of fossil evidence from the New World than from the Old World. If we were to postulate new world monkey ancestors, then the apparent tapetum lucidum presence would no longer be out of place. I do not know if it is right or not but it seems an adequate and elegant solution. That being the case, it seems a mistake to dismiss it on mere beliefs not backed by evidence which is what has happened so far. MIB
  8. norseman

    The hunted

    Packing in by mule string! Very cool!
  9. Arent we at a point that anything to do with Melba Ketchum is just Comedy fodder
  10. By comparison I will have to agree Unless the nests in the Olympic Peninsula were made by Unicorns even though there was no apparent Unicorn DNA noted in the samples Dr. Ketchum was a geneticist who dealt with thoroughbred horses however so maybe, just maybe.......NAAAAAAH!
  11. Hiflier I really doubt there would be a whole forum devoted to anything THAT strange! Lol But this is more mainstream that a lot of the stuff out there!
  12. Are you kidding me? This whole subject is strange
  13. hiflier

    The case for Homo Erectus

    Or even a LOT
  14. This seems to be the case. I wish we could find a military guy that was present at the Mt. Saint Helens bigfoot cover up. The whole story is strange. Agree, and is there any proof?
  15. 7.62

    The case for Homo Erectus

    What did he find in the morning?
  16. Incorrigible1

    The case for Homo Erectus

    Hey, if folks can postulate telepathic, terrain- gliding woods-ninjas, I figure I'm granted a little leeway.
  17. hiflier

    The case for Homo Erectus

    THAT would be a real eye opener.
  18. Yesterday
  19. Incorrigible1

    The case for Homo Erectus

    Perhaps another, completely unknown species, probably primate. New World origination
  20. Saffasquatch

    The case for Homo Erectus

    I don't understand...
  21. NCBFr

    The case for Homo Erectus

    My next door neighbor listened to a deer get torn apart in the middle of the night between our two houses. He described it as the most horrific thing he has ever listened to .
  22. adam2323

    The hunted

    Hey Norse the location is in north eastern Tuolumne County Ca. I grew up there lived there my entire life. My dad lived there since the 1940’s. I learned the location from one from the Sardellas who own the pack station at Kennedy Meadows. That’s the where they were packed into the location from . My Dad and Joe Sardella are life long pals so he showed me the location one summer.
  23. BlackRockBigfoot

    The case for Homo Erectus

    I mentioned this in another thread recently. The preternatural speed and agility that is so often discussed in accounts does not seem to be found in video evidence. The only two videos that I can think of that show anything like that are the baby Bigfoot tree swinging video and one (from Russia I believe) that showed a primate basically smoothly moving through the underbrush at a high rate of speed.
  24. NCBFr

    The case for Homo Erectus

    Here is a version of a much older video showing a BF running on all fours. I am sure somebody will post that is a a proven hoax but it sure looks good to me and has been in my top 10 BFs video list for a long time. https://sasquatchchronicles.com/forums/topic/bigfoot-chasing-on-all-fours-video/
  25. Incorrigible1

    The case for Homo Erectus

    ^^ Umm, "the possibility of something like the De Loy's ape......."
  26. Saffasquatch

    The case for Homo Erectus

    Who are you replying to? The topic in general? What is your alternate hypothesis? That it's more like a gorilla? Gigantopithecus? To me by far the more likely hypothesis is the one OP stated, that it is a primitive late surviving hominid and that is what Dr. Meldrum thinks too (though he originally believed the gigantopithecus explanation). The only genus of primate that primarily walks upright we know for sure has survived into the modern age is homo. Let me deconstruct your argument. "Now, dig into basic knowledge of what an early modern human might be like and their lifestyle and behaviors" Early modern humans? Modern humans usually refers to Homo sapiens. I assume you mean Erectus, Paranthropus, Heidelbergensis etc. Which are usually referred to as primitive humans. Anything more primitive than Erectus that are usually not called humans or homo. Lifestyle and behaviours? It is hard to figure out exactly how Erectus lived since you know, they're all dead (or are they?). We know they lived in groups, used a wide variety of tools. Some populations may have used fires, others may not have. I have seen convincing evidence that bigfoot uses tools, such as the NAWAC (North American Wood Ape Conservancy) which showed pictures of rocks that were used to crush nuts (what they call nut cracking stations). Also teepee like structures which are recorded all across America indicates not only advanced cognitive processes but advanced dexterity. Also wood knocks are thought to come from sticks being hit against trees which would also count as tool use. These are certainly more advanced than other great apes, but not as advanced as later homo that made advanced stone tools and fire. So what was your argument here? What behaviours contradict this hypothesis? Yes it's a stretch, but so is anything to do with bigfoot. We are looking for explanations of a creature which is not verified yet and has no concrete fossil evidence, any theory sounds ridiculous to the average paleontologist. What have you got? De Loy's Ape is not convincing at all to me. It looks too much like a Spider monkey, and even if it isn't (which is unlikely) it doesn't have the anatomy of an upright walking ape. Notice it's feet have extended opposable halluces (big toes) which is useful for climbing trees but not for walking. It is not found in any humanoid. In fact part of the definition of the genus homo is that it's upright walking.
  27. Or maybe it's just a matter of our means of counting them has improved (or gotten a whole lot worse and we're counting some multiple times...)I In regards to finding a body, and having it taken by authorities to prove they are in on it, well I d suggest that even if they don't take the body that there s still plenty of reason to think the government has known for a good long while...since it you can get one, it's pretty much a given that they did long ago and said nothing of it to the public!
  28. Twist

    P-G Filmsite, 1967 and 2018

    Typically leaves turn color roughly the same time each year, the primary factor being light. With that said other conditions can change the timing some such as drought. Just an FYI.
  1. Load more activity
×
×
  • Create New...