Release Of Forensic Dna Results For Sierra Kills Sample

[Guest]

i know little about dna & how contamination may skew the end result, but I find it a pretty far stretch. if this was a murder case and the lab was testing for the DNA of the victim, what are the odds of it coming back "bear"? c'mon, really?

[Guest slimwitless]

Anyone here ever see Rashomon?

[Rockape]

So, "how do you get around what should the predominant contributor, noticeably absent?"

There are 2 types of disruption that will kill the PCR amplification of a target nucleic acid: 1) nucleotide insertions and 2) nucleotide deletions. Oligonucleotide primers (or just "primers" are designed to associate with a complementary DNA sequence of determined length. So, typically a researcher will look at a stretch of defined DNA sequence and design 2 primers (one commonly called the "forward primer" and one called the "reverse primer") based on a number of criteria that the researcher feels confident will lead to good performance in the assay. Let's say the researcher decides on primers that are 20 nucleotides in length and sends in an order to have them synthesized to specification. The primers are tested against known targets and they work as expected, i.e. they match perfectly or nearly perfectly with all 20 nucleotides each in the targets (DNA) of interest and give the expected results. Hurray! Now, it is true that primers can tolerate some kinds of mismatches in the specified sequence and still work - that's generally how universal primers work across a broad specturm of species. But insertions and deletions are difficult because they create unique physical constraints in the pairing of primers and target DNA. It will only take one insertion or deletion in either forward or reverse primer to pretty much kill the amplification of that specific DNA. So, if you have a mix where predominant (unknown) DNA has a bad match due to insertion/deletion you get no amplification, whereas the known matching DNA targets will amplify preferentially.

The problem here is that insertions and deletions are also very disruptive to protein coding sequences, and there may be evolutionary pressures against such disruptions. However, disruptions in sequences outside of protein coding regions may be more forgiving (and therefore evolutionarily acceptable). I am not familiar with the design of these primers, so I can't assess the probability of this occuring here, but it is certainly possible.

So, how might MK have gotten around this? Well, in her press release and interviews she has identified "Next Generation Sequencing" as the technology platform that has generated her most convincing data. Next Generation Sequencing is a relatively new technology platform that couples generic nucleic acid (DNA) amplification with high-throughput sequencing. It uses much shorter oligonucleotide primers to pretty much amplify all DNA in a sample for sequencing. The sequence data is rapidly fed into very powerful computer software that sorts and aligns the information. The view of the sample would be much more comprehensive and pitfalls due to insertions/deletions would be avoided or rendered insignificant due to massive amounts of corroborative information. It is a tremendous investigative tool, but would also have technical pitfalls of its own. I believe that some have indicated that this work was actually contracted out to labs with expertise and the appropriate instruments and computer systems.

So, that is one possible explanation. However, there still seems to be a strong case for bear.

Great post tomafoot and thanks for what you have been bringing to the conversation, though I really don't understand all of it. So, being someone who knows nothing about DNA I will try to phrase this question in a way that makes sense.

It is said (I believe) that Melba Ketchum developed special primers for her DNA study. If I am right about that, what could these special primers be? Could she have used DNA from past hominids, say Neanderthal or any other that would be available? Would that be what enables her to extract DNA where others fail? Or would modern human DNA do the same job?

Edited January 4, 2013 by Rockape

[Guest tomafoot]

I'm open for scenarios that may have caused our two labs to miss. Hell, I fought hard for something like that when I was receiving their results. I should have had you handy then.

What would be the mechanism for this "insertion or deletion"?

And I'm not sure if I caught what exactly would be inserted or deleted. Like, what would the insertion of a nucleotide look like? I'll have to give it a second read.

Okay, let me see, if I can illustrate this in a straight forward way. Hopefully, I don't get tripped up by formatting issues.

Here is a portion of non-coding sequence (that is to say it does not contain information that determines the amino acid sequence of the protein) from brewer's yeast cytochrome b.

5'ATTTTCTCCGTATTCATTATTATATTATCTAATTTATAAAATATTTAAAGACTTATAATAATATAACATCTTTGTAAATTATTGTTAAAG3'

3'TAAAAGAGGCATAAGTAATAATATAATAGATTAAATATTTTATAAATTTCTGAATATTATTATATTGTAGAAACATTTAATAACAATTTC5'

Let's say this is the sequence I have and I'd like to use it to detect wild yeasts out in the environment. So, I design my 2 primers based on sequence in red and blue. So long as there are exact or near exact matches between target and primer, I will detect. However let's say I have sample containing a yeast whose sequence looks like this at the red target due to a G:C basepair insertion in the middle:

5'CTCCGTATTCATTAGTTATATTATCTAAT......

3'GAGGCATAAGTAATCAATATAATAGATTA.......

That single insertion, which would result from a proofreading error in the DNA replication of some ancestor yeast, significantly disrupts the pairing of my primer and the target DNA. In this case I would not be able to detect the unknown wild yeast using my PCR assay. However, I would detect brewer's yeast or other yeasts with the same or similar sequence in my sample.

GTATTCATTATTATATTATC->

3'GAGGCATAAGTAATCAATATAATAGATTA.......

A deletion (also due to a proof reading error in DNA replication) would cause a similar type of misalignment between primer and target. Hopefully, that helps.

It is said (I believe) that Melba Ketchum developed special primers for her DNA study. If I am right about that, what could these special primers be? Could she have used DNA from past hominids, say Neanderthal or any other that would be available? Would that be what enables her to extract DNA where others fail? Or would modern human DNA do the same job?

Two possibilities that I can think of: 1) the "special" primers may be the short primers that are used in the Next Generation Sequencing approach - they are short and will latch onto target DNA somewhat indescriminately so that just about everything in the mix gets amplified and then sorted out by genetic sequence information - and 2) she may have generated sequence information and then designed very specific primers that would allow her to do quick and easy assessments of incoming samples. I thought she has said that her sequences are different from known hominid (e.g. neanderthal and denisovan) sequences.

And it isn't necessarily a matter of "extracting DNA where others fail," but actually amplifying the DNA where others were unable to because her primers are different.

I think the key information that has come from MK is that she has a lot of sequence. Once you have the sequence sorted out and you begin comparing it to other sequences, things begin to fall into place.

[Guest]

Because it's not wise to have evidence on your person if you think may have committed murder? Just speculating.

I did ask for possibilities and that's a good one. There are also variations. For example, the sample did not test as BF but she wanted someone to believe otherwise.

Please note that although I believe the Smeja sample is a central part of the study, I never claimed she said it publicly. From my perspective, all evidence is either circumstantial or based on hearsay.

If he didn't take a picture due to fear of murder, why proceed to then murder another one, especially a juvenile?

[Guest OntarioSquatch]

I remember that Dr. Ketchum publicly denied there being anything paranormal in the paper soon after RL stirred things up with the Angel DNA stuff.

Edited January 4, 2013 by OntarioSquatch

[Guest FootDude]

My issue with footdude's post should be obvious as he's repeating Dr. Ketchum's points about both data and timelines in which he has zero substantiation to share to back up his statements, then remarkably turning around and saying (and encouraging others) Tyler and I are doing what he's doing, yet we just threw our first lab report down and have been more then willing to answer questions. In addition, as I mentioned, questioning someone (footdude) who's providing nothing to back up his statements of fact on behalf of Dr Ketchum are not inferences of fraud, neither is asking a legit question to CTfoot in the context of what he was discussing.

With regards to Ketchum, I'm not repeating any of her points. I'm merely stating obvious conclusions based on the evidence you've presented so far...ie the only thing you can definitively show is that Smeja most likely gave you bear meat. Everything else you claim is moot because you haven't offered any hard evidence to back your claims. Since Ketchum's study isn't even public yet, ANYTHING you say with regards to that is completely unfounded at this point.

I refer you to my earlier post:

Ahhh...

So the crux of this matter is you are inferring that Ketchum is a fraud.

Fair enough.

Post your evidence.

I am willing to listen.

Happy New Year!

Edited January 4, 2013 by FootDude

[Guest Theagenes]

No Mulder, YOU claimed she DENIED saying it - those are your words. So it's up to you to provide proof that she denied it. I never asserted that she DID say it, I only asked you to prove that she denied it. I heard her choose her words very carefully on a radio interview, when asked. She said 'some people think that' but she never DENIED having made claims about extraterrestrial sources, or angel DNA, etc. I'm just asking you to provide proof of your claim that she has categorically denied saying that. If I had ever claimed that she said it, then I should provide proof of my claim. I only claim heresay on that one, and admit it. But it was heresay from prominent players in this story. A major benefactor, a major sample provider, and a major research contributor as well as Stubstad and a more recent advisor and contributor. They all claimed it, but I admit I can't prove it. You however claim she denied it - please provide the denial.

Tyler, to be fair she did deny that there was anything paranormal in her paper a few weeks ago on FB:

I really think we should absolutely stop using RL for a source of information even if he is a blind squirrel that occasionally finds a nut. He also just rips off speculation from posts here and and repeats it as "inside information." In fact if you go back to when the "Angel DNA" comments first appeared on RL's blog, it was right after there were some oblique "Nephilim" comments in the "Ketchum Report" thread.

Edited January 4, 2013 by Theagenes

[Guest]

I wonder if Todd Disotell would issue a FB statement saying that there are no paranormal aspects of a paper that he is writing? Why does she even address it?

[Guest Theagenes]

I agree. If i were in her position my only response would have been to have an attorney send RL a C&D letter.

[Guest]

I found a review from 2007 on the use of hair in forensic analysis and your statement is true, but the shaft would not be the source of choice - sort of a desparation move. Still, it's always a good day when you learn something new. So, thanks for the pointer.

Another point to make is that an mtDNA hair test should be pretty cheap to get done, and ought to give a clear +ve for either bear or human.

I'd guess a basic HVR1 test wouldn't cost more than $100?

If the lab were told the hair is human and they came back with bear, I would think that's a slam-dunk.

(I'm assuming that hair samples, whilst less 'giving' in terms of dna material, may for this reason be less prone to contamination.)

[Guest slimwitless]

If he didn't take a picture due to fear of murder, why proceed to then murder another one, especially a juvenile?

The first one was a "monster". Two or three minutes passed after he shot the juvenile where some "stuff happened" that he still hasn't revealed publicly. The only thing we know for sure is that he thought the eyes looked very human.

Edit to add: This is all in the shooting thread. I'm just offering possibilities.

Edited January 4, 2013 by slimwitless

[southernyahoo]

Okay, let me see, if I can illustrate this in a straight forward way. Hopefully, I don't get tripped up by formatting issues.

Here is a portion of non-coding sequence (that is to say it does not contain information that determines the amino acid sequence of the protein) from brewer's yeast cytochrome b.

5'ATTTTCTCCGTATTCATTATTATATTATCTAATTTATAAAATATTTAAAGACTTATAATAATATAACATCTTTGTAAATTATTGTTAAAG3'

3'TAAAAGAGGCATAAGTAATAATATAATAGATTAAATATTTTATAAATTTCTGAATATTATTATATTGTAGAAACATTTAATAACAATTTC5'

Let's say this is the sequence I have and I'd like to use it to detect wild yeasts out in the environment. So, I design my 2 primers based on sequence in red and blue. So long as there are exact or near exact matches between target and primer, I will detect. However let's say I have sample containing a yeast whose sequence looks like this at the red target due to a G:C basepair insertion in the middle:

5'CTCCGTATTCATTAGTTATATTATCTAAT......

3'GAGGCATAAGTAATCAATATAATAGATTA.......

That single insertion, which would result from a proofreading error in the DNA replication of some ancestor yeast, significantly disrupts the pairing of my primer and the target DNA. In this case I would not be able to detect the unknown wild yeast using my PCR assay. However, I would detect brewer's yeast or other yeasts with the same or similar sequence in my sample.

GTATTCATTATTATATTATC->

3'GAGGCATAAGTAATCAATATAATAGATTA.......

A deletion (also due to a proof reading error in DNA replication) would cause a similar type of misalignment between primer and target. Hopefully, that helps.

Two possibilities that I can think of: 1) the "special" primers may be the short primers that are used in the Next Generation Sequencing approach - they are short and will latch onto target DNA somewhat indescriminately so that just about everything in the mix gets amplified and then sorted out by genetic sequence information - and 2) she may have generated sequence information and then designed very specific primers that would allow her to do quick and easy assessments of incoming samples. I thought she has said that her sequences are different from known hominid (e.g. neanderthal and denisovan) sequences.

And it isn't necessarily a matter of "extracting DNA where others fail," but actually amplifying the DNA where others were unable to because her primers are different.

I think the key information that has come from MK is that she has a lot of sequence. Once you have the sequence sorted out and you begin comparing it to other sequences, things begin to fall into place.

Great post tomafoot, that does explain how other DNA wouldn't amplify. Could the short primers in next generation sequencing, eroneously assemble bogus sequences to fill in gaps created by degradation?

[Guest OntarioSquatch]

I wonder if Todd Disotell would issue a FB statement saying that there are no paranormal aspects of a paper that he is writing? Why does she even address it?

People are accusing her of mentioning things like Angel DNA and some other crazy stuff. If RL were to target Dr. Disotell with the same kind of stuff I'm pretty sure he would eventually have to make some sort of statement as well.

[Cisco]

Okay, let me see, if I can illustrate this in a straight forward way. Hopefully, I don't get tripped up by formatting issues.

Here is a portion of non-coding sequence (that is to say it does not contain information that determines the amino acid sequence of the protein) from brewer's yeast cytochrome b.

5'ATTTTCTCCGTATTCATTATTATATTATCTAATTTATAAAATATTTAAAGACTTATAATAATATAACATCTTTGTAAATTATTGTTAAAG3'

3'TAAAAGAGGCATAAGTAATAATATAATAGATTAAATATTTTATAAATTTCTGAATATTATTATATTGTAGAAACATTTAATAACAATTTC5'

Let's say this is the sequence I have and I'd like to use it to detect wild yeasts out in the environment. So, I design my 2 primers based on sequence in red and blue. So long as there are exact or near exact matches between target and primer, I will detect. However let's say I have sample containing a yeast whose sequence looks like this at the red target due to a G:C basepair insertion in the middle:

5'CTCCGTATTCATTAGTTATATTATCTAAT......

3'GAGGCATAAGTAATCAATATAATAGATTA.......

That single insertion, which would result from a proofreading error in the DNA replication of some ancestor yeast, significantly disrupts the pairing of my primer and the target DNA. In this case I would not be able to detect the unknown wild yeast using my PCR assay. However, I would detect brewer's yeast or other yeasts with the same or similar sequence in my sample.

GTATTCATTATTATATTATC->

3'GAGGCATAAGTAATCAATATAATAGATTA.......

A deletion (also due to a proof reading error in DNA replication) would cause a similar type of misalignment between primer and target. Hopefully, that helps.

Two possibilities that I can think of: 1) the "special" primers may be the short primers that are used in the Next Generation Sequencing approach - they are short and will latch onto target DNA somewhat indescriminately so that just about everything in the mix gets amplified and then sorted out by genetic sequence information - and 2) she may have generated sequence information and then designed very specific primers that would allow her to do quick and easy assessments of incoming samples. I thought she has said that her sequences are different from known hominid (e.g. neanderthal and denisovan) sequences.

And it isn't necessarily a matter of "extracting DNA where others fail," but actually amplifying the DNA where others were unable to because her primers are different.

I think the key information that has come from MK is that she has a lot of sequence. Once you have the sequence sorted out and you begin comparing it to other sequences, things begin to fall into place.

Tomafoot,

Here's a simple question:

Given what you just explained; is it possible, with this technology, MK could have detected Bigfoot DNA from the same sample that was tested by B&T and came back as black bear?

Please try to answer in layman terms so it's easy to understand. I'm just barely starting to understand DNA so don't lob it over my head. Thx