Release Of Forensic Dna Results For Sierra Kills Sample

[Guest Tyler H]

Throughout my efforts in this saga, I have had the pleasure of interaction with some very well-educated, very sharp scientists (geneticists, biologists, anthropologists, etc.)

One of them has provided me with this analysis that goes beyond my payscale, but does seem salient to my layman's mind. Hopefully it can be further addressed by some of the appropriately educated people here. This particular source of mine doesn't really "do" blogs, so is unlikely to be available for comment.

From a copy of a sequence file related to Sample 26, a preliminary analysis was performed using the BLAST (Basic Local Alignment Tool) at the National Center for Biotechnology Information (NCBI).

Here is what was found:

1) mostly human sequences returned

2) some bear sequences turn up as highly significant matches

3) probable sequencing errors (incomplete or poorly proofread/unconfirmed nucleotide sequences)

4) potential method- or system-specific artifacts that significantly undermine the interpretation of the data

A further look at one of the bear sequences, brain-derived neurotrophic factor (BDNF), provides a good illustration of the problems at hand. Only a partial sequence of the bear gene seems to be present (red type below). Oddly enough, there appears to be sequences for human BDNF immediately adjacent (blue type below) to it. This would appear to be a major artifact due to bear and human genomes present in the sample, with subsequent misinterpretation by the system software during the construction of a consensus sequence. There are potentially common sequencing artifacts (green type) that are flagged by the BLAST algorithm. Additionally, and not surprisingly, there appear to be insertions (orange type) and deletions (fuchsia type) that commonly occur in the method, suggesting a lack of quality control of the sequencing output. Finally, there are sequences which don't really match anything (black type). Because they occur as very short stretches they also appear to be artifactual, and, again, suggest poor quality control.

Such sequencing data would typically be viewed as incomplete and unfit for interpretation, let alone publication. Sure, we can say that there is bear and human associated with the sequence, but it will be difficult to claim that there is sequence from an unknown primate in the mix, especially if it aligns closely with human. The "human" sequence was analyzed further by aligning with gorilla, chimpanzee, and orangutan homologs to see if the sequenc might show characteristics of a non-human primate. The sequence did not display characteristics suggesting anything other than human.

>Sample 26 unknown BDNF

GTTACAGTGTTTCACAGAGAGAGGGCCGTGTTGGCAGGTGCAGAGCCCAGCTCCCCAGATGGAATCATCTTTTCCTTATTAATTTGCTGCGTGTTGCTTCGCATTTCTCGCAGTCGTTCCAAATGTGTTACAAACGACTACA

TGCTCTGGGTCCTGAATCCACGACTGCTGAGGACTTTGCAAGCTCCCTGGACAGATTGGGATCGAGTAATTCATCTCATTGGATCTGTTCTTCCATATACACAACACAAGTCAATGTTTGTTATGACTTTCTTGATCCTTATTT

ATAAGACAATACAAGAGGAAACCATGTGTGTATGTTTGAAATAGAAATGATACATTGCACAGATATAGTTCACCACGTTCTGGGATGGGTTGTCAGTGTTCAAATGGGGAGTCTGAAAGAGTAGGAACAGATGCTTTTTTTC

CTTAATGGCTCTTTCTCTAATTTAAAATCCTTCCATTTATTTCCCTAAGATTTAGTGATAACTTTAAACACTTTAACTAAATTACCCAGCGGCTTGGCAGCCATCACAGAGGCAAATCTTTTTAGAAATCCTAGCAATCTGTTAG

ATCATGGGTACTATGATATAAAATCTGCATGCTTCACATACAAAAATTAAATCAGTGCAATGGATACAAATGCATAATGCAAATGGCACCATTGACTTTCTAAATTTGGGCCAATTTATTCTCATTATTCCTAAGTAAACCTACT

TTGATTTTTTTTTTTAACAGTTATTTTATAATCAAATAGAGCCAGCCAGCCCTGCTTCATGGATCCTGATGTTGCTAGGATACATGGTTTGTACTTGATGAAAGTATATCACTTCAAAGGAGAAAACTTTCAAGTGTCCTAGAAT

ATGACACTGGGCTGTGCAATTGCTAAAACTAGTCAGGTTGGTCTTAAAGCAAGGAACACACGTATTTATAATAAAACACGTTTTCATGTTTGGTTTTACAGTGAAGAGAAAAAACCCAGAACCCCCAGATTTTATGTACTTTG

AAAATATATTTAAAAACATTAAAAATTCTATATTTAAAACATATATTATATGTTAATTAGTACACTTAAATAGAACTTGTATTTACATAGGCTTCTGATGCGGTTAAGTTTTAATGCCAATTTTTTTCAATAACACAATTATATAAA

TATACTAAAATACAATAAATATTTTTTTTTTGTTTTACATGGTGAATAATATCTTTACCATAGAGAAAACAAGGCCACAGACATTTACTTACATTTTCAATGGCAATCACCATAAAAAAGCAACAGGCCTGCTGGCATGCATGA

AAACACTTCTGCCACAAAGAGACCACAGCAAGACTTTAAAAAACAAAACACAACAAAACAAAAACTGAACAGCAACAGAGAAAGATTTTAACAAAATAAATCTTAGGTCAACATAAGCCACCAAGCATGTGACTGTGATGTA

TCCTATTGGGTAAGAGAGCCAGTGACCACGCAATTGCTCAGTGTCTCCTCCAGCGAGAACCTCTTAGCACAGTTAGATAATGTAGGCACTTAAAGCACGAGGTCCAAGCAACTTGATGCAGTCATTCCAGAGCCACCTCTG

AAAGGTCCTTCAGAGGCCTCCCTTCTGGAATGTCTCAAGTACCATTCCCCACCATCAACCAGAATATATATTGAAGGAATTCTTTCCCCATCCCTACTCCCTATGGGAACTAAAGAAAACAAAACAAAAACAAAACAAAACAA

CAAAACAAACATATACCCCTCCCATCCCCCATTCCCTAAGCCAGTAAAGCGATGACAACAGCACCTTGACATTGTTTTAATTCCAACGCTATCAGAAGTTAAAAGCAGTAAAACAGATAATAGTACTAACAAGAACGAAGATA

CTTACTGTCTAAAACGTAAATGGAATGTTTTGGTTCAAATTTTTTTTTTTTTTTTTTTTTTTTTGTCTGTTTTCTGAAAGAGGACAGTTTATTATCAATTCACAATTAAAGCAGCATGCAATTTATTATTATTATTTTTTTAAACTTTT

TTACGTTTTCAATTCTTGGCAACGGCAACAAACCACAACATTATCGAGGAATGTAATGCAGACTTTTTAGAGTTGTGCGCAAGATGACTGTTTCCCTTCTGGTCATGGATAGGTCCAATAAATAGATTGTAGAACCACTGTAC

TGTATAAACTTCATTTATACATGCAGTTCATAAAATTATTTTTTTCTTAACTGAATAATTTACCCTGTTATGTATATATACAAATAGATAATTTTTGTCTCAATATAATCTATACAACATAAATCCACTATCTTCCCCTTTTAATGGT

CAGTGTACATACACAGGAAGTGTCTATCCTTATGAATCGCCAGCCAATTCTCTTTTTGCTATCCATGGTAAGGGCCCGCACGTACGACTGGGTAGTTCGGCACTGGGAGTTCCAATGCCTTTTGTCTATGCCCCTGCAGCCC

TCCTTTGTGTAACCCATGGGATTGCACTTGGTCTCATAGAAGTACTGCTTCAGTTGGCCTTTCGATGACCCTCATAGACATGTTTGCAGCATCCAGGTAATTTTTGTATTCCTCAAGCAGAAAGAGAAGAGGAGGCTCCAAA

GGCACTTGACTACTGAGCATCACCCTGGAAGTATACAAGTCCGCGTCCTTATTGTTCTCCTCACTGGGCCGGACTTTCTGGTCCTCGTCCAGCAGCTCTTCTATCACGTGTTCAAAAGTGTCAGCCAAGGAAGTCAGGCCTC

TCGAACCTGCCTTGGGCCCATTCACGCTCTCCAGAGTCCCATGGGTCCGCACACCTGGGTAGGCCAAGCTGCCTTGTCCTCGGACGTTTGCTTCCTTCATGGGGGCAGCCTTCATGCAACCGAAGTATGAAATAACCATAG

TAAGGAAAAGGATGGTCATCACTCTTCTCACCTGGTGGAACTGTAGGGAGAAAGCAGAAAGAGGACACAGGACTTGTTAGGGCTTTCTTCTGCAGGGATGCAGTGTGGCCTTTTGGAATAGGCAGCTAGTGCTTCTTTCTG

TGCTTTTGAAGTTTTCTGGGAAGTCCCTTAACAGCACACCACAAAATTAATCTTTTCCTGTTTGCCAGAGAGCCATGTGGACCCCGTTCCAGAAACTGGCCATGTTCCAGAGCTACTATAAA

Red = Bear

Blue = primate

Green = artifactual

Orange = possible insertion (possible artifact)

Fuchsia = possible deletion (possible artifact)

Black = unknown (unidentifiable, possible artifact)

Edited February 17, 2013 by Tyler H

[Guest njjohn]

Interesting report from your friend Tyler. Just a question though.... the last two lines... If it did turn out that it is a human hybrid with something somewhere related to human... would you expect to see it come back as human? Even Ketchum's study said there was nothing that came back primate.

I've done a short crash course myself but really can't understand 99.9% of it, but whenever I hear another account of it I get questions that pop up that could possibly teach me more.

[Guest DWA]

Ummmmm....no body right?

Then...no answer.

[Guest slimwitless]

Tyler, I know you participated in the Henner Fahrenbach thread back in the fall of 2011. The very mysterious and knowledgeable Ginger3 signed up to reveal the salt-dried sample from the shooting was likely not sasquatch because it had a pronounced medulla, an undercoat and strong tapering.

Smeja chimed in and said Ginger3 was wrong on one of these points. Do you know what he meant? I understand Ketchum is claiming her sample had no guard hairs.

Ginger3 also said: "DNA research on their sample has been hampered due to contamination. Only Ketchum has had clean samples."

Did someone else try DNA testing the salt-dried sample before Bart sent it off to his lab?

[TimB]

That "partial bear dna sequence" makes me wonder. How could they not get a full sequence if it's a sample from a bear? Never mind- I won't understand the answer either.

Tim B.

[Guest ajciani]

It certainly can be confusing. What Tyler has there is essentially nothing, in terms of bear and human and dog and whale and bumble bee genes.

A BLAST does nothing more than try to align genetic sequences with known genes. The problem is that genes have a lot of repeating structural units, used in multiple genes across multiple species. Think of a BLAST like taking a post on this forum, and then looking for what other posts contain a sequence of letters or words similar to it.

For example, what if we have no idea what topic the above text came from? We can find the phrase "multiple species" under the "Different Bf Species?" topic (red). We can find "the problem is that" in the "Consequences for Hoaxers" topic (blue). So maybe the above text is actually from the "Consequences for Hoaxing Multiple Species" topic? But this topic does not exist. The result of our search makes no sense. That is because this post is unique, but the phrases it contains may be used in many others.

Basically, what Tyler is showing there is proof that the genetic sequences Ketchum obtained are unique, and have never been cataloged, otherwise the BLAST would have hit something definitive.

Now, as for the veracity of Justin Smeja's statements. The Ketchum paper contains an image of what Smeja sent to her. It is not bear. It is a piece of dermis (skin) along with subcutaneous adipose tissue (the fatty layer under the skin). The skin is covered with hair. Not fur. Not a double coat like most animals have, but a single layer of hair. The tissue is also in very good condition. If it was human tissue, the result would have come back clearly human. If it was bear tissue (which you can tell it is not, just by looking) the result would have been definitive bear. If it was a chunk of orangutan, it would have come back orangutan.

So now we have the problem. What Smeja sent to Ketchum, with a cursory visual examination, is clearly not bear, or any other furred animal. What Smeja has published on-line, and what Smeja sent to Tyler is, just by looking at it, from a furred animal, probably bear. It does not even matter what the DNA says, because the naked eye can see that the samples are distinctly different.

BTW, Ketchum never believed Smeja. She believed he shot some bigfoots, but she never believed his story about how it happened, or his story about how he collected the sample. She does a lot of forensic work, and she is certain that he collected the sample shortly after he shot them. It was in that good a shape. The image in her paper appears to back it up.

Tyler, IMO He shot one or two bigfoots. Collected samples, maybe even bodies, right then and there, and then sent you bear.

Edited February 26, 2013 by AaronD
to remove slander of another member

[Guest ajciani]

Oh, I should add.

The Ketchum effort did not BLAST across every known species. That would take forever. They BLASTed across all of the large and common fauna in North America, and the other apes (just in case someone tried to slip some chimpanzee in). Bear was included in the BLAST, so there will be the occasional partial bear hit. There were also some dog hits, and some possum hits, and some deer hits, but never anything more than fragments, except for the human hits. The human hits were always interspersed with unknowns, and on continuous strands of DNA.

[Guest Orygun]

Tyler,IMO He shot one or two bigfoots. Collected samples, maybe even bodies, right then and there, and then sent you bear.

Logic says that he shot a bear, collected contaminated samples and sent a bear. Evidence also supports this.

Good luck disputing that.

Edited February 26, 2013 by Orygun
to edit quoted material that was in violation

[Guest slimwitless]

Logic says that he shot a bear, collected contaminated samples and sent a bear. Evidence also supports this.

Good luck disputing that.

Logic says bigfoot does not exist.

And yet here we are.

[Guest Theagenes]

Tyler and/or Bart and/or Derek,

I was wondering if you guys could clarify part of the timeline for me. I tried searching back through this thread to find it all but was only partially successful.

Tyler, your report is dated November 15, 2012, so presumably you got it on or shortly after that date.

Then you told Derek the results, correct? And Derek told MK, and MK contacted Tyler and asked him to hold off on releasing the results. Is all that correct and if so, when did these conversations take place? Were they before or after the Burtsev Leak/MK Press Release on November 23-24?

Thanks.

[Guest Theagenes]

It certainly can be confusing. What Tyler has there is essentially nothing, in terms of bear and human and dog and whale and bumble bee genes.

A BLAST does nothing more than try to align genetic sequences with known genes. The problem is that genes have a lot of repeating structural units, used in multiple genes across multiple species. Think of a BLAST like taking a post on this forum, and then looking for what other posts contain a sequence of letters or words similar to it.

For example, what if we have no idea what topic the above text came from? We can find the phrase "multiple species" under the "Different Bf Species?" topic (red). We can find "the problem is that" in the "Consequences for Hoaxers" topic (blue). So maybe the above text is actually from the "Consequences for Hoaxing Multiple Species" topic? But this topic does not exist. The result of our search makes no sense. That is because this post is unique, but the phrases it contains may be used in many others.

Basically, what Tyler is showing there is proof that the genetic sequences Ketchum obtained are unique, and have never been cataloged, otherwise the BLAST would have hit something definitive.

Now, as for the veracity of Justin Smeja's statements. The Ketchum paper contains an image of what Smeja sent to her. It is not bear. It is a piece of dermis (skin) along with subcutaneous adipose tissue (the fatty layer under the skin). The skin is covered with hair. Not fur. Not a double coat like most animals have, but a single layer of hair. The tissue is also in very good condition. If it was human tissue, the result would have come back clearly human. If it was bear tissue (which you can tell it is not, just by looking) the result would have been definitive bear. If it was a chunk of orangutan, it would have come back orangutan.

So now we have the problem. What Smeja sent to Ketchum, with a cursory visual examination, is clearly not bear, or any other furred animal. What Smeja has published on-line, and what Smeja sent to Tyler is, just by looking at it, from a furred animal, probably bear. It does not even matter what the DNA says, because the naked eye can see that the samples are distinctly different.

BTW, Ketchum never believed Smeja. She believed he shot some bigfoots, but she never believed his story about how it happened, or his story about how he collected the sample. She does a lot of forensic work, and she is certain that he collected the sample shortly after he shot them. It was in that good a shape. The image in her paper appears to back it up.

Tyler, IMO He shot one or two bigfoots. Collected samples, maybe even bodies, right then and there, and then sent you bear.

AJ, you raise some fair points, but I would question your following statement:

It does not even matter what the DNA says, because the naked eye can see that the samples are distinctly different.

I would absolutely not trust my own eyes looking at image on a computer over DNA evidence. But regardless, I would argue that the sample MK shows in her report is not distinctly different from some of those shown by Smeja. The ones that only showed fur did look different, but the ones where tissue is visible look very similar to MK's sample.

Specifically, this one:

http://2.bp.blogspot...akillssteak.jpg

And the one on RL's blog that showed a piece of flesh with long "blonde" hair attached to it. (I don't think I'm allowed to post pic or link from RL, correct?)

Edited February 26, 2013 by AaronD
to edit quoted material that contained violations

[Guest DWA]

Logic says bigfoot does not exist.

And yet here we are.

Actually, logic doesn't say that. Logic never goes against evidence.

(I'm not hijacking this thread. Take it up here:)

http://bigfootforums.com/index.php?/topic/33198-bigfoot-research-%e2%80%93-still-no-evidence-but-plenty-of-excuses-to-explain-why-there%e2%80%99s-no-evidence/

Edited February 20, 2013 by DWA

[Guest slimwitless]

Actually, logic doesn't say that. Logic never goes against evidence.

I don't disagree. It was a lame attempt at humor. Not my strong suite.

Anyway...Tyler/Bart, any thoughts on why Justin thought Ginger3 was wrong on one aspect of the salted sample's hair morphology?

[Guest ajciani]

I would absolutely not trust my own eyes looking at image on a computer over DNA evidence. But regardless, I would argue that the sample MK shows in her report is not distinctly different from some of those shown by Smeja. The ones that only showed fur did look different, but the ones where tissue is visible look very similar to MK's sample.

And the one on RL's blog that showed a piece of flesh with long "blonde" hair attached to it. (I don't think I'm allowed to post pic or link from RL, correct?)

Did Smeja published images of different pieces of flesh. The only Smeja image I am aware of looks like bear. The chunk in the image you posted from Bigfoot Evidence is the same one published by Ketchum (you need to mirror and rotate the image, and the spots line up perfectly). It does not appear that image came from Smeja, but probably from Ketchum.

While computer images are not as great as looking at things close-up, they are frequently used to communicate the appearance of samples, and they can be good enough to identify whether something is fur or hair, especially if it shows a cross-section through the coat. The only image that I know of that came from Smeja is definitely fur.

In addition to the DNA, both Ketchum and Trent did a visual inspection of the samples. Trent noted that the hairs were a perfect match to bear. Ketchum noted that the hairs on her sample were consistent with the unknown (i.e. bigfoot), which was discernible from bear.

So big problem: Samples appear different, hairs appear different, and DNA is very different. Also, the sample Ketchum received is in much better condition than would have been expected of something Smeja found laying on the ground at the site. Smeja's story has not made sense to many people, and the alarm bells keep going off. I do not know what he sent to Ketchum, but it was not bear, and it seems to be consistent with primate. I do know what he sent to Trent, and it was bear.

[Guest slimwitless]

This image was leaked long before the study. I happen to think it's consistent with MKs image (and no, it doesn't look like bear at first glance).

LINK