Release Of Forensic Dna Results For Sierra Kills Sample

[Guest Theagenes]

Thanks Slim, that's the one I was talking about.

Did Smeja published images of different pieces of flesh. The only Smeja image I am aware of looks like bear. The chunk in the image you posted from Bigfoot Evidence is the same one published by Ketchum (you need to mirror and rotate the image, and the spots line up perfectly). It does not appear that image came from Smeja, but probably from Ketchum.

Yes the image that Slim posted above is another image from Justin. You're about the BF Evidence piece--it does appear to the same one from MK's report except her's has a small piece cut off. But that's good, because now everyone can compare MK's piece (the one above from BFE) with another piece that Justin produced (Slim's link above). I believe Bart said his report will have images as well for further comparison. If all you've seen were the original fur pics of the steak, then I don't blame you for thinking they look different because they do. Part of that may have been due to storage methods as well---the frozen pieces will look different from the ones that were dried and salted.

While computer images are not as great as looking at things close-up, they are frequently used to communicate the appearance of samples, and they can be good enough to identify whether something is fur or hair, especially if it shows a cross-section through the coat. The only image that I know of that came from Smeja is definitely fur.

In addition to the DNA, both Ketchum and Trent did a visual inspection of the samples. Trent noted that the hairs were a perfect match to bear. Ketchum noted that the hairs on her sample were consistent with the unknown (i.e. bigfoot), which was discernible from bear.

Actually that's not what she said at all.

She made several very general statements about like "most of the novel hairs had medullary structures and diameter ratios that were clearly distinct from human hairs" and "most of the submitted hairs were not microscopically consistent with any of the hairs from the reference collection of common animal hairs." Note her use of the qualifier "most"---she's never actual identifies which samples these are specifically.

On the Sierra kills sample though she had a more thorough analysis done. She does not say it is inconsistent with bear. She says it is inconsistent with human. Here is the actual quote:

"There was no pathology present in sample 26, however the histology was deemed inconsistent with human skin. Examination revealed lesser numbers of eccrine glands and even sebaceous gland/pilosebaceous gland units than normally seen in human skin. Abnormalities such as abortive hair shafts and various alopecias were detected and hair follicle addition or extra follicles, clustered and deeper in the dermal region were noted. The clustering of follicles at a deeper level in the dermis than where most skin appendages usually occur was unusual and not generally associated with hair follicle loss as is seen with alopecia."

So big problem: Samples appear different, hairs appear different, and DNA is very different. Also, the sample Ketchum received is in much better condition than would have been expected of something Smeja found laying on the ground at the site. Smeja's story has not made sense to many people, and the alarm bells keep going off. I do not know what he sent to Ketchum, but it was not bear, and it seems to be consistent with primate. I do know what he sent to Trent, and it was bear.

Yes big problem indeed. You are making some very matter-of-fact statements with very little qualification---less qualification than MK herself is making as she is very careful in her wording to leave herself an out.

Take a look at the microscopic image of the medulla from the Sierra Kills sample that MK has in her report (Fig. 5B) and then compare it the bottom left image below. That's the medulla of a Black Bear taken at the same resolution (400X). Are you still willing to say definitively that you know that the Sierra Kills sample that MK tested is not bear?

Source:

Huffman, Jane E. and John R. Wallace. Wildlife Forensics: Methods and Applications. Wiley & Sons, 2011. p. 138.

[Guest njjohn]

Theagenes - Given the poor quality of the image, it's not definitive but the medulla's have a different width and pattern. Of course through the blind eye, it's impossible to note the exact differences. The report also doesn't report which hair was for Justin's sample. Most of the 100+ samples were hair, and the report says most were of that type. A better cross sampling of the hair magnification for each sample would definitely be a plus.

[Guest Theagenes]

Theagenes - Given the poor quality of the image, it's not definitive but the medulla's have a different width and pattern. Of course through the blind eye, it's impossible to note the exact differences. The report also doesn't report which hair was for Justin's sample. Most of the 100+ samples were hair, and the report says most were of that type. A better cross sampling of the hair magnification for each sample would definitely be a plus.

Sample 26 is Justin's sample.

Let me be clear on what I'm saying. I'm not arguing here whether or not the sample is bear or BF. I'm not making any statement as to Justin's veracity. All I'm saying is that it is over-reaching to declare definitively that the Sierra Kills sample is not bear and is not from the same sample Justin gave to Bart and Tyler, based on the images we've been given.

[southernyahoo]

Throughout my efforts in this saga, I have had the pleasure of interaction with some very well-educated, very sharp scientists (geneticists, biologists, anthropologists, etc.)

One of them has provided me with this analysis that goes beyond my payscale, but does seem salient to my layman's mind. Hopefully it can be further addressed by some of the appropriately educated people here. This particular source of mine doesn't really "do" blogs, so is unlikely to be available for comment.

From a copy of a sequence file related to Sample 26, a preliminary analysis was performed using the BLAST (Basic Local Alignment Tool) at the National Center for Biotechnology Information (NCBI).

Here is what was found:

1) mostly human sequences returned

2) some bear sequences turn up as highly significant matches

3) probable sequencing errors (incomplete or poorly proofread/unconfirmed nucleotide sequences)

4) potential method- or system-specific artifacts that significantly undermine the interpretation of the data

A further look at one of the bear sequences, brain-derived neurotrophic factor (BDNF), provides a good illustration of the problems at hand. Only a partial sequence of the bear gene seems to be present (red type below). Oddly enough, there appears to be sequences for human BDNF immediately adjacent (blue type below) to it. This would appear to be a major artifact due to bear and human genomes present in the sample, with subsequent misinterpretation by the system software during the construction of a consensus sequence. There are potentially common sequencing artifacts (green type) that are flagged by the BLAST algorithm. Additionally, and not surprisingly, there appear to be insertions (orange type) and deletions (fuchsia type) that commonly occur in the method, suggesting a lack of quality control of the sequencing output. Finally, there are sequences which don't really match anything (black type). Because they occur as very short stretches they also appear to be artifactual, and, again, suggest poor quality control.

Such sequencing data would typically be viewed as incomplete and unfit for interpretation, let alone publication. Sure, we can say that there is bear and human associated with the sequence, but it will be difficult to claim that there is sequence from an unknown primate in the mix, especially if it aligns closely with human. The "human" sequence was analyzed further by aligning with gorilla, chimpanzee, and orangutan homologs to see if the sequenc might show characteristics of a non-human primate. The sequence did not display characteristics suggesting anything other than human.

>Sample 26 unknown BDNF

GTTACAGTGTTTCACAGAGAGAGGGCCGTGTTGGCAGGTGCAGAGCCCAGCTCCCCAGATGGAATCATCTTTTCCTTATTAATTTGCTGCGTGTTGCTTCGCATTTCTCGCAGTCGTTCCAAATGTGTTACAAACGACTACA

TGCTCTGGGTCCTGAATCCACGACTGCTGAGGACTTTGCAAGCTCCCTGGACAGATTGGGATCGAGTAATTCATCTCATTGGATCTGTTCTTCCATATACACAACACAAGTCAATGTTTGTTATGACTTTCTTGATCCTTATTT

ATAAGACAATACAAGAGGAAACCATGTGTGTATGTTTGAAATAGAAATGATACATTGCACAGATATAGTTCACCACGTTCTGGGATGGGTTGTCAGTGTTCAAATGGGGAGTCTGAAAGAGTAGGAACAGATGCTTTTTTTC

CTTAATGGCTCTTTCTCTAATTTAAAATCCTTCCATTTATTTCCCTAAGATTTAGTGATAACTTTAAACACTTTAACTAAATTACCCAGCGGCTTGGCAGCCATCACAGAGGCAAATCTTTTTAGAAATCCTAGCAATCTGTTAG

ATCATGGGTACTATGATATAAAATCTGCATGCTTCACATACAAAAATTAAATCAGTGCAATGGATACAAATGCATAATGCAAATGGCACCATTGACTTTCTAAATTTGGGCCAATTTATTCTCATTATTCCTAAGTAAACCTACT

TTGATTTTTTTTTTTAACAGTTATTTTATAATCAAATAGAGCCAGCCAGCCCTGCTTCATGGATCCTGATGTTGCTAGGATACATGGTTTGTACTTGATGAAAGTATATCACTTCAAAGGAGAAAACTTTCAAGTGTCCTAGAAT

ATGACACTGGGCTGTGCAATTGCTAAAACTAGTCAGGTTGGTCTTAAAGCAAGGAACACACGTATTTATAATAAAACACGTTTTCATGTTTGGTTTTACAGTGAAGAGAAAAAACCCAGAACCCCCAGATTTTATGTACTTTG

AAAATATATTTAAAAACATTAAAAATTCTATATTTAAAACATATATTATATGTTAATTAGTACACTTAAATAGAACTTGTATTTACATAGGCTTCTGATGCGGTTAAGTTTTAATGCCAATTTTTTTCAATAACACAATTATATAAA

TATACTAAAATACAATAAATATTTTTTTTTTGTTTTACATGGTGAATAATATCTTTACCATAGAGAAAACAAGGCCACAGACATTTACTTACATTTTCAATGGCAATCACCATAAAAAAGCAACAGGCCTGCTGGCATGCATGA

AAACACTTCTGCCACAAAGAGACCACAGCAAGACTTTAAAAAACAAAACACAACAAAACAAAAACTGAACAGCAACAGAGAAAGATTTTAACAAAATAAATCTTAGGTCAACATAAGCCACCAAGCATGTGACTGTGATGTA

TCCTATTGGGTAAGAGAGCCAGTGACCACGCAATTGCTCAGTGTCTCCTCCAGCGAGAACCTCTTAGCACAGTTAGATAATGTAGGCACTTAAAGCACGAGGTCCAAGCAACTTGATGCAGTCATTCCAGAGCCACCTCTG

AAAGGTCCTTCAGAGGCCTCCCTTCTGGAATGTCTCAAGTACCATTCCCCACCATCAACCAGAATATATATTGAAGGAATTCTTTCCCCATCCCTACTCCCTATGGGAACTAAAGAAAACAAAACAAAAACAAAACAAAACAA

CAAAACAAACATATACCCCTCCCATCCCCCATTCCCTAAGCCAGTAAAGCGATGACAACAGCACCTTGACATTGTTTTAATTCCAACGCTATCAGAAGTTAAAAGCAGTAAAACAGATAATAGTACTAACAAGAACGAAGATA

CTTACTGTCTAAAACGTAAATGGAATGTTTTGGTTCAAATTTTTTTTTTTTTTTTTTTTTTTTTGTCTGTTTTCTGAAAGAGGACAGTTTATTATCAATTCACAATTAAAGCAGCATGCAATTTATTATTATTATTTTTTTAAACTTTT

TTACGTTTTCAATTCTTGGCAACGGCAACAAACCACAACATTATCGAGGAATGTAATGCAGACTTTTTAGAGTTGTGCGCAAGATGACTGTTTCCCTTCTGGTCATGGATAGGTCCAATAAATAGATTGTAGAACCACTGTAC

TGTATAAACTTCATTTATACATGCAGTTCATAAAATTATTTTTTTCTTAACTGAATAATTTACCCTGTTATGTATATATACAAATAGATAATTTTTGTCTCAATATAATCTATACAACATAAATCCACTATCTTCCCCTTTTAATGGT

CAGTGTACATACACAGGAAGTGTCTATCCTTATGAATCGCCAGCCAATTCTCTTTTTGCTATCCATGGTAAGGGCCCGCACGTACGACTGGGTAGTTCGGCACTGGGAGTTCCAATGCCTTTTGTCTATGCCCCTGCAGCCC

TCCTTTGTGTAACCCATGGGATTGCACTTGGTCTCATAGAAGTACTGCTTCAGTTGGCCTTTCGATGACCCTCATAGACATGTTTGCAGCATCCAGGTAATTTTTGTATTCCTCAAGCAGAAAGAGAAGAGGAGGCTCCAAA

GGCACTTGACTACTGAGCATCACCCTGGAAGTATACAAGTCCGCGTCCTTATTGTTCTCCTCACTGGGCCGGACTTTCTGGTCCTCGTCCAGCAGCTCTTCTATCACGTGTTCAAAAGTGTCAGCCAAGGAAGTCAGGCCTC

TCGAACCTGCCTTGGGCCCATTCACGCTCTCCAGAGTCCCATGGGTCCGCACACCTGGGTAGGCCAAGCTGCCTTGTCCTCGGACGTTTGCTTCCTTCATGGGGGCAGCCTTCATGCAACCGAAGTATGAAATAACCATAG

TAAGGAAAAGGATGGTCATCACTCTTCTCACCTGGTGGAACTGTAGGGAGAAAGCAGAAAGAGGACACAGGACTTGTTAGGGCTTTCTTCTGCAGGGATGCAGTGTGGCCTTTTGGAATAGGCAGCTAGTGCTTCTTTCTG

TGCTTTTGAAGTTTTCTGGGAAGTCCCTTAACAGCACACCACAAAATTAATCTTTTCCTGTTTGCCAGAGAGCCATGTGGACCCCGTTCCAGAAACTGGCCATGTTCCAGAGCTACTATAAA

Red = Bear

Blue = primate

Green = artifactual

Orange = possible insertion (possible artifact)

Fuchsia = possible deletion (possible artifact)

Black = unknown (unidentifiable, possible artifact)

Tyler, does this correlate with something Dr. Ketchum told you in private?

[Guest ajciani]

If all you've seen were the original fur pics of the steak, then I don't blame you for thinking they look different because they do. Part of that may have been due to storage methods as well---the frozen pieces will look different from the ones that were dried and salted.

I have no expectation that salt (NaCl) would change the color or structure of hair. Skin and flesh, yes. Hair, no. Now, if he used lye, lime, or salt peter, those may have had an effect on the color or structure. Lye or lime would have come pretty close to destroying the samples.

Actually that's not what she said at all.

She made several very general statements about like "most of the novel hairs had medullary structures and diameter ratios that were clearly distinct from human hairs" and "most of the submitted hairs were not microscopically consistent with any of the hairs from the reference collection of common animal hairs." Note her use of the qualifier "most"---she's never actual identifies which samples these are specifically.

Actually, some of my information came from private conversations. She is quite emphatic that what she has could in no way be mistaken for bear, especially due to a lack of guard hairs and fur.

You also need to consider the logic of her print statements. 1) Most of the novel hairs were inconsistent with human hairs in both medullary structures and diameter ratios, meaning that some of the novel hairs were consistent with human medullary structure and/or diameter ratios; however, they were still identifiable as novel, and distinct from human hairs by scale pattern, root structure, or some other metric. 2) Most of the submitted hairs were inconsistent with the reference samples, meaning that few of the samples could be identified as coming from a known North American or primate animal. It means that the submitters had good cause to suspect their samples came from a bigfoot.

On the Sierra kills sample though she had a more thorough analysis done. She does not say it is inconsistent with bear. She says it is inconsistent with human. Here is the actual quote:

"There was no pathology present in sample 26, however the histology was deemed inconsistent with human skin. Examination revealed lesser numbers of eccrine glands and even sebaceous gland/pilosebaceous gland units than normally seen in human skin. Abnormalities such as abortive hair shafts and various alopecias were detected and hair follicle addition or extra follicles, clustered and deeper in the dermal region were noted. The clustering of follicles at a deeper level in the dermis than where most skin appendages usually occur was unusual and not generally associated with hair follicle loss as is seen with alopecia."

The hair morphology of sample 26 had already ruled out bear, as it was consistent with the unknowns, which were not consistent with the knowns (including bear). The additional analysis was done to identify how the unknown, which contained human mtDNA, was different from normal human skin (i.e. why sample 26 could not be a piece of human scalp).

Yes big problem indeed. You are making some very matter-of-fact statements with very little qualification---less qualification than MK herself is making as she is very careful in her wording to leave herself an out.

First, the pictures are more than enough qualification. One is obviously hair, the other is obviously fur. Second, MK left herself no such out. Sample 26 is consistent with the unknown, which is not consistent with the knowns, and only occasionally, in a few aspects, consistent with human.

Take a look at the microscopic image of the medulla from the Sierra Kills sample that MK has in her report (Fig. 5B) and then compare it the bottom left image below. That's the medulla of a Black Bear taken at the same resolution (400X). Are you still willing to say definitively that you know that the Sierra Kills sample that MK tested is not bear?

The diameter ratios between sample 26 and the bear example look similar, but the structure of the medula is only one aspect of hair analysis. Ketchum also had scale patterns and the roots analyzed, and they were distinct from bear and human. One might say that bigfoot hair is thick and hollow, like the guard hairs of a bear, but that is where the similarity ends.

On visual inspection, the most important clue is that the samples sent to Ketchum had only hairs and no fur, with no indication that the fur had somehow been pulled out.

[Guest]

Tyler, does this correlate with something Dr. Ketchum told you in private?

Bingo.

Did Justin ever make that statement that was maybe coming a few weekends ago? There's been a lot of dancing around the elephant in the room, although Bart came pretty close in the Ketchum thread today. Any chance anyone wants to put out there yet what was said that raised all the red flags?

[Guest]

Do we have Bart's report out now including the thermals? I thought that was forthcoming very soon?

[Guest Tyler H]

Sorry guys, I've had enough trouble finding time to answer questions on the Ketchum thread - I hadn't even realized this thread had become active again.

Tyler, I know you participated in the Henner Fahrenbach thread back in the fall of 2011. The very mysterious and knowledgeable Ginger3 signed up to reveal the salt-dried sample from the shooting was likely not sasquatch because it had a pronounced medulla, an undercoat and strong tapering.

Smeja chimed in and said Ginger3 was wrong on one of these points. Do you know what he meant? I understand Ketchum is claiming her sample had no guard hairs.

Ginger3 also said: "DNA research on their sample has been hampered due to contamination. Only Ketchum has had clean samples."

Did someone else try DNA testing the salt-dried sample before Bart sent it off to his lab?

I can say fairly confidently that the statemend by Ginger are accurate by the information I have - I'm not sure what Justin would have been referring to. Ginger's statement jives with the information I got from Fahrenbach and Meldrum.

Meldrum only had the salted sample - I believe he had trouble testing it. No one else had any prior to Bart testing it.

Melba had unsalted pieces at the time.

For a while we thought Justin could be in breach of some NDA, so we played our cards close to our chest. Justin is now quite sure he never signed that NDA that others did.

That "partial bear dna sequence" makes me wonder. How could they not get a full sequence if it's a sample from a bear? Never mind- I won't understand the answer either.

Tim B.

That's easy - state of decay can accomplish that

It certainly can be confusing. What Tyler has there is essentially nothing, in terms of bear and human and dog and whale and bumble bee genes.

A BLAST does nothing more than try to align genetic sequences with known genes. The problem is that genes have a lot of repeating structural units, used in multiple genes across multiple species. Think of a BLAST like taking a post on this forum, and then looking for what other posts contain a sequence of letters or words similar to it.

For example, what if we have no idea what topic the above text came from? We can find the phrase "multiple species" under the "Different Bf Species?" topic (red). We can find "the problem is that" in the "Consequences for Hoaxers" topic (blue). So maybe the above text is actually from the "Consequences for Hoaxing Multiple Species" topic? But this topic does not exist. The result of our search makes no sense. That is because this post is unique, but the phrases it contains may be used in many others.

Basically, what Tyler is showing there is proof that the genetic sequences Ketchum obtained are unique, and have never been cataloged, otherwise the BLAST would have hit something definitive.

Now, as for the veracity of Justin Smeja's statements. The Ketchum paper contains an image of what Smeja sent to her. It is not bear. It is a piece of dermis (skin) along with subcutaneous adipose tissue (the fatty layer under the skin). The skin is covered with hair. Not fur. Not a double coat like most animals have, but a single layer of hair. The tissue is also in very good condition. If it was human tissue, the result would have come back clearly human. If it was bear tissue (which you can tell it is not, just by looking) the result would have been definitive bear. If it was a chunk of orangutan, it would have come back orangutan.

So now we have the problem. What Smeja sent to Ketchum, with a cursory visual examination, is clearly not bear, or any other furred animal. What Smeja has published on-line, and what Smeja sent to Tyler is, just by looking at it, from a furred animal, probably bear. It does not even matter what the DNA says, because the naked eye can see that the samples are distinctly different.

BTW, Ketchum never believed Smeja. She believed he shot some bigfoots, but she never believed his story about how it happened, or his story about how he collected the sample. She does a lot of forensic work, and she is certain that he collected the sample shortly after he shot them. It was in that good a shape. The image in her paper appears to back it up.

Tyler, IMO He shot one or two bigfoots. Collected samples, maybe even bodies, right then and there, and then sent you bear.

AJCIANI - You are a master wizard with the "facts as you want them to be" and would be great at dodgeball, because you deliberately avoid all of the actual scientific analysis of the genomic data. ALL qualified scientists that I know of on this forum have pointed out how it's not JUST a matter of Melba having unique DNA - it's that that DNA is not related to anything normal on this planet. So, if that is the case, how were my lab and Bart's lab able to match the tissue to human and bear? ANswer - (which has been sstated time and time and time again, and I'm tired of wasting my valuable time on it) - the illumina system has stitched together sequences from all contributors present. I have posted data that supports that, from a very qualified scientist who had hoped Melba's report would be valid. Species do NOT differ THAT much from all other species. The 3 mapped genomes could not differ from one another to the extent that they do, if these species were AT ALL related to eachother. Now, if you want to stick with your arguments, your only choice is to go where Melba went - call these samples "Angel DNA" or "Alien DNA" beccause it is not conforming to the DNA of any other SINGLE mammalian DNA. It IS however conforming as expected, if you make a frankenstein DNA from bear and human, for example... or dog and human,. etc.

If you want to refute my statements, find where I have quoted the PhD in question and attack his data and his conclusions - don't just use analogies that don't hold up.

And neither does your "well, I don't think the compressed images on my computer look rightr, t omatch your DNA results.

Give me a break. I had several taxidermists look at those pictures. None of them could agree what it looked like it came from. You can't tell from a picture.

Did Smeja published images of different pieces of flesh. The only Smeja image I am aware of looks like bear. The chunk in the image you posted from Bigfoot Evidence is the same one published by Ketchum (you need to mirror and rotate the image, and the spots line up perfectly). It does not appear that image came from Smeja, but probably from Ketchum.

While computer images are not as great as looking at things close-up, they are frequently used to communicate the appearance of samples, and they can be good enough to identify whether something is fur or hair, especially if it shows a cross-section through the coat. The only image that I know of that came from Smeja is definitely fur.

In addition to the DNA, both Ketchum and Trent did a visual inspection of the samples. Trent noted that the hairs were a perfect match to bear. Ketchum noted that the hairs on her sample were consistent with the unknown (i.e. bigfoot), which was discernible from bear.

So big problem: Samples appear different, hairs appear different, and DNA is very different. Also, the sample Ketchum received is in much better condition than would have been expected of something Smeja found laying on the ground at the site. Smeja's story has not made sense to many people, and the alarm bells keep going off. I do not know what he sent to Ketchum, but it was not bear, and it seems to be consistent with primate. I do know what he sent to Trent, and it was bear.

No, that is NOT a big problem - Ketchum has said nearly everything she worked with was "unidentified"

If a kid looks up and sees a helicopter, and then says it's a UFO... I guess they are right - to them it is unidentified. But when someone who knows aircraft looks at it, and says "it's a helicopter" you can't then use ridiculous reasoning and say "yes, but we have a conflict here... the kid says it's unidentifiable" Once someone identifies it, it's identified, and no longer unknown.

Tyler, does this correlate with something Dr. Ketchum told you in private?

Not sure what you mean, SY?

Tyler and/or Bart and/or Derek,

I was wondering if you guys could clarify part of the timeline for me. I tried searching back through this thread to find it all but was only partially successful.

Tyler, your report is dated November 15, 2012, so presumably you got it on or shortly after that date.

Then you told Derek the results, correct? And Derek told MK, and MK contacted Tyler and asked him to hold off on releasing the results. Is all that correct and if so, when did these conversations take place? Were they before or after the Burtsev Leak/MK Press Release on November 23-24?

Thanks.

My first convo after obtaining results, with Melba was December 3, 2012.

Derek was informed much earlier - I had wanted to let Derek know directly, as he always thought I was out to undermine him, and I wanted to tell him first when we had our results, so he could see that was not my intent. But it so happened I believe, that he and Bart were talking more, and he found out from Bart first. Bart would have to comment on that date.

Bart's report will be out right away - I think he is aiming for tomorrow.

Meldrum has been promising a hair morphology analysis.

I touched base with him last week - he said I can stand by that statement, it has just been slow in coming.

Edited February 26, 2013 by Tyler H
to edit quoted material that was in violation

[Guest BartloJays]

I apologize as I completely forgot about this thread and have missed a weeks' discussion. will try and respond in a bit.

Cornelius- OK report is out tomorrow and thermal within two weeks as I just got Phil Polings footage breakdown and it's pretty epic as he also put the real time audio with the 18 min or so of footage all in real time. the audio will end after 15 min of discussion at camp (it was my backup on my head as primary was in treeline acrosss camp) because it ran out of space. Only thing missing audio-wise was when me and Sanh went back up and got them again in same spot and got the rock-drop/ rock throwing iincident recorded. Check your PM Cornelius

[Guest Tyler H]

I am going to make this post, just so that I can see posts which I suspect are there, but will not become visible to me until I make another post.

[Guest Tyler H]

Bart's report came out yesterday.

[Cotter]

I apologize, but where can the report be found?

(I should know this...)

[Guest]

Bart's report came out yesterday.

I hate to say it, I got tired of it with the AE film.. ....but how much longer before this thermal comes out, and why is it taking so long? Now I will walk away and punish myself by standing in the corner.

[Guest Tyler H]

Let me check with Bart. Wasn't sure if he was going to add it to this thread, or start a new one... but it IS available at the Sierra Evidence Initiative site http://www.sierrasiteproject.com/

Hey Treadstone, Bart has been very disappointed that he has not been able to release the thermal video yet. The video is done, and presentable as it is, I believe, but Bart the perfectionist always thinks of something else that could make the presentation just a bit better... should be right away though!

It's not incontrovertible evidence, but it's pretty compelling, and very interesting for those of us who know the animal exists, and even more interesting for those of us who also know the site, and who know Bart is not hoaxing, and is extremely unlikely to have been hoaxed.

[chelefoot]

Has Barts Thermal been posted yet?