Unknown Primate Dna

[hiflier]

Hello thermalman,

 

My cow is more real than any blurry thermal image of an imaginary BF.

I find that rather insulting. How soon you forget that that very "blurry thermal image" is also your "cow".

 

 

Extraordinary claims require extraordinary evidence.

Agreed. No argument there.

 

Shall we leave the Brown's thermal out of this thread?

Edited February 4, 2014 by hiflier

[Guest Urkelbot]

^^^And that's what I mean by "a debate between people who just want to be right."  Can't even get what you said read back at you straight.

What that is, is a scientist saying something that you just buy.

 

If you think that's the same thing as seeing a kouprey in the wild - or even a halfway-decent film of one, the only one ever being from 1957 and none too good - well more power to you.

 

But that's why you're doing 80 pages of posts on a headless cow. 

If you don't want to buy what the scientists are saying feel free to do the analysis yourself.  There is plenty of alignment software out there to compare it against other bovine species.  NCBI blast is easy

http://blast.ncbi.nlm.nih.gov/Blast.cgi

 

Here's the code for the cytochrome oxidase subunit II gene from the kouprey.

ATGGCATATCCCATACAACTAGGCTTCCAAGATGCAACATCACCAATCATAGAAGAACTGCTTCACTTTC

ATGACCACACGCTAATAATTGTCTTTTTAATTAGCTCATTAGTACTTTACATTATTTCACTAATACTAAC

GACAAAACTGACTCACACAAGCACAATAGATGCACAAGAAGTAGAGACAATCTGAACTATTCTACCCGCT

ATTATTTTAATTCTAATTGCTCTTCCTTCTTTACGAATCCTGTATATAATGGATGAAATCAATAACCCAT

CCCTTACGGTAAAAACCATAGGACATCAGTGATACTGAAGCTACGAATACACAGATTATGAGGACTTAAG

CTTCGACTCCTACATAATTCCAACATCAGAATTAAAGCCAGGGGAGCTACGACTATTAGAAGTCGATAAT

CGAGTTGTACTGCCAATAGAAATAACAATCCGAATGCTAGTCTCCTCTGAAGACGTACTACACTCATGAG

CCGTGCCTTCTCTAGGACTGAAAACAGACGCAATTCCAGGCCGTCTGAACCAAACAACCCTCATATCGAC

CCGCCCAGGC

 

There is a lot more Kouprey gene sequences here at 

http://www.ncbi.nlm.nih.gov/nuccore/?term=kouprey.  

[Guest DWA]

...and if they'd follow up on the sasquatch evidence, we'd have it for that, too.

 

Again:  the only significant difference is that scientists are paying attention to one, and not even reviewing the evidence for the other.

 

And the only evidence of this an intelligent person needs is what they, themselves, say about sasquatch.

 

How could analysis as slam-dunk as anything done for that cow not even be making a ripple? 

 

http://woodape.org/index.php/about-bigfoot/articles/90-anatomy-and-dermatoglyphics-of-three-sasquatch-footprints

http://woodape.org/index.php/about-bigfoot/articles/91-anatomy-of-the-sasquatch-foot

http://woodape.org/index.php/about-bigfoot/articles/92-population-clines-of-the-north-american-sasquatch-as-evidenced-by-track-lengths-and-estimated-statures

 

All those analyses use is...plain old common sense.  With an extremely hefty dose of good old-fashioned science.

 

Get anybody you can, with any qualifications, and let's see him contradict those.

 

And nobody's seen a kouprey since 1988 and they're still looking.  Better proof that people are funny, one could not ever come up with.

"If we were simply dealing with an over-sized subspecies of an accepted animal, such footprints would probably gain general acceptance. As it is, however, we should not be surprised if the best-of all-possible foot impressions of a Sasquatch were ignored or denied by most of the scientific establishment. That is exactly what we are now confronted with."  - Grover Krantz.

 

Yup.  Underlined and double-bold.

 

For any dyed-in-the-wool adherent of scientific method, the only difference between reading those analyses and feeding a kouprey, personally, by hand, would be that we haven't finished the job for the ape yet.  The hand feeding is totally touchy feely; the reality is objective.

 

It's simple.  Here's your kouprey:

 

--------------------------------------------

 

If you don't want to buy what the scientists are saying feel free to do the analysis yourself.  There is plenty of alignment software out there to compare it against other bovine species.  NCBI blast is easy

http://blast.ncbi.nl...h.gov/Blast.cgi

 

Here's the code for the cytochrome oxidase subunit II gene from the kouprey.

ATGGCATATCCCATACAACTAGGCTTCCAAGATGCAACATCACCAATCATAGAAGAACTGCTTCACTTTC
ATGACCACACGCTAATAATTGTCTTTTTAATTAGCTCATTAGTACTTTACATTATTTCACTAATACTAAC
GACAAAACTGACTCACACAAGCACAATAGATGCACAAGAAGTAGAGACAATCTGAACTATTCTACCCGCT
ATTATTTTAATTCTAATTGCTCTTCCTTCTTTACGAATCCTGTATATAATGGATGAAATCAATAACCCAT
CCCTTACGGTAAAAACCATAGGACATCAGTGATACTGAAGCTACGAATACACAGATTATGAGGACTTAAG
CTTCGACTCCTACATAATTCCAACATCAGAATTAAAGCCAGGGGAGCTACGACTATTAGAAGTCGATAAT
CGAGTTGTACTGCCAATAGAAATAACAATCCGAATGCTAGTCTCCTCTGAAGACGTACTACACTCATGAG
CCGTGCCTTCTCTAGGACTGAAAACAGACGCAATTCCAGGCCGTCTGAACCAAACAACCCTCATATCGAC
CCGCCCAGGC

 

There is a lot more Kouprey gene sequences here at 

http://www.ncbi.nlm....e/?term=kouprey.

------------------------

 

To a layman, that's not a kouprey.  To anyone, my links?  Hmmmmmmm.  They sound like sasquatch.  And other than that, the sasquatch has more evidence.  Just strictly to a scientist, now.  Were he, of course, objective, he'd say:  [waving papers while petting kouprey] I want to get this ape in the room, too.

 

That this isn't even starting to happen, really, says all one needs to know.

Edited February 4, 2014 by DWA

[southernyahoo]

So now Sykes is tainted and a fame and fortune seeker?  

 

I'd say there is something to resolve in why the bigfoot samples would require a $2000.00 test. Maybe it has to do with the methods applied to hairs being different from those applied to a cheek swab, or he is doing something more comprehensive once he finds what he is looking for. Still if he only did a quick mito check, I'd be looking for a partial refund. Since he's not saying what he would call BF DNA there is no tipping point where a full refund would be in order.

[Guest DWA]

So now Sykes is tainted and a fame and fortune seeker?  

 

Naaaaaaaaah, just doesn't want to be proven wrong, that's all.  I get it.

[Guest thermalman]

Hello thermalman,

 

 

Shall we leave the Brown's thermal out of this thread?

Just illustrating a point. Left it behind hours ago.

[hiflier]

Hello thermalman,

 

 

Just illustrating a point. Left it behind hours ago.

 

 

Doesn't excuse what you said: "imaginary BF"........a regrettable claim. 

[Guest Llawgoch]

Naaaaaaaaah, just doesn't want to be proven wrong, that's all.  I get it.

 

Proven wrong about what exactly?

[Guest thermalman]

^^Oh boy. "eye-roll" Again,.... Left it behind hours ago.

Edited February 4, 2014 by thermalman

[hiflier]

Hello thermalman,

 

OK.

[Guest Urkelbot]

...and if they'd follow up on the sasquatch evidence, we'd have it for that, too.

 

Again:  the only significant difference is that scientists are paying attention to one, and not even reviewing the evidence for the other.

 

And the only evidence of this an intelligent person needs is what they, themselves, say about sasquatch.

 

How could analysis as slam-dunk as anything done for that cow not even be making a ripple? 

 

http://woodape.org/index.php/about-bigfoot/articles/90-anatomy-and-dermatoglyphics-of-three-sasquatch-footprints

http://woodape.org/index.php/about-bigfoot/articles/91-anatomy-of-the-sasquatch-foot

http://woodape.org/index.php/about-bigfoot/articles/92-population-clines-of-the-north-american-sasquatch-as-evidenced-by-track-lengths-and-estimated-statures

 

All those analyses use is...plain old common sense.  With an extremely hefty dose of good old-fashioned science.

 

 

 

Scientists paid attention because they had live and dead animals documented by scientists, body parts, fossils that matched modern bones, and tissue to extract DNA from.  

 

Bigfoot has none of that at this point. If any were to be found science and more importantly money will get involved.  

 

Look at the dates on those articles you posted.  Nothing has really changed since then lots more sightings and foot prints but drat no actual foot to vindicate the assumptions in the papers.  

[southernyahoo]

What is "unknown primate DNA" without the primate?

 

 

Proof to science that an unknown primate/ great ape lives here.

[Guest DWA]

^^^Actually, not so much.  It could be a degraded hair from a known primate, part of the reason, I'd wager, why that result doesn't mean much to the mainstream unless recognizable parts accompany it.

Urkelbot:

 

They paid attention because they had proof?  Little of the great science that has been done - virtually none, in fact - was done by people who had the proof already.

Why should I trust the scientists who can't give me a thesis that makes sense where all those sightings and footprints are coming from over those analyses, plus lots of people whose eyes virtually never fail them, you know, pretty much like you and me?

[dmaker]

I'd say there is something to resolve in why the bigfoot samples would require a $2000.00 test. Maybe it has to do with the methods applied to hairs being different from those applied to a cheek swab, or he is doing something more comprehensive once he finds what he is looking for. Still if he only did a quick mito check, I'd be looking for a partial refund. Since he's not saying what he would call BF DNA there is no tipping point where a full refund would be in order.

Or perhaps he is setting the price of admission higher so that he is not buried in carpet fibers and dog hairs.  History has a tendency to repeat after all..

[Guest DWA]

Not saying a man doesn't have a right to fair recompense for his services.  But price is a bar that might keep good stuff from getting tested for no other reason than that someone couldn't afford it.

 

Which simply underscores again that what Sykes is doing - admirable as it is - can't be said to be a significant impact on the evidence, one way or the other.  Unless of course, he actually finds what those sending in samples are looking for.