The Ketchum Report

[Guest]

Bartlojays said:

[/size]

I have no problem confirming what Bart said in the post above are just some of the things we discussed. I never once got the impression from Bart he or Justin ever thought any of this was a slam dunk whether it be Trent or Melba. As Bart said to me many times - if the tests come back Bigfoot - they come back Bigfoot If they don't - then they don't. But I can say I felt Bart and Justin went the Trent route maybe out of frustration at getting no information and at times concern about what they were being told by Melba.

Bart and Justin both made some pretty tough decisions. I would not want to be in the position either of them were in.

So, basically what your saying is - if I take my car to a repair shop and they do horrible work - it's my fault and not the fault of the car repair shop? C'mon.. If you want to lay blame on the submitters that's your thing, not mine. I don't blame these people - it was and is up to Ketchum to prove her work - not those who submitted the samples.

so you are saying that submitter's actually had bigfoot samples, and mk just failed proving they were bigfoot samples ? that doesn't work, she is not the only one worked on the project and clarifed the data. Or, your saying that all the samples were bad, the submitter's are either sadly mistaken, crazy, hoaxers, etc... and MK

was wrong becuase not one of the sample were real.sorry melissa, you keep trying to smash this paper and for some odd reason you want to blame her for every thing, she is not the only person involved with the project

your car analogy is comparing apples to atom bombs, coundn't be farther apart. to think it's "the shops fault" or" your fault" there could be many reasons why it wasn't the shops fault, could have been defective parts, your car could be defective, you cperate the vechile inproperly causing the failure, Etc... Even your simple analogy can turn into a complex problem, and with the complexity of the study and so many different people and bussiness involved, it's not fair to blame one person.

Edited February 16, 2013 by zigoapex

[Guest]

Thank you GenesRus - for adding your take on this situation. I have been anxiously awaiting your input. I figured you would be along when you could. So, thank you.

I gotta say - between GenesRus and Theagenes - my hopes for this paper are absolutely crushed. I would say over the last 5 years - I have remained silent - until the last few months - which is not in my character at all. I hoped, in the end, that Melba would pull this out and the question of whether bigfoot exists or not would be proven through DNA testing and her peer reviewed article.

Melba now says she has scientists reviewing her article. I hope she is open to whatever they say - and I still hope their is some way of salvaging this. I just don't know...

Zigoapex said:

so you are saying that submitter's actually had bigfoot samples, and mk just failed proving they were bigfoot samples ? that doesn't work, she is not the only one worked on the project and clarifed the data. Or, your saying that all the samples were bad, the submitter's are either sadly mistaken, crazy, hoaxers, etc... and MK was wrong becuase not one of the sample were real.sorry melissa, you keep trying to smash this paper and for some odd reason you want to blame her for every thing, she is not the only person involved with the project your car analogy is comparing apples to atom bombs, coundn't be farther apart. to think it's "the shops fault" or" your fault" there could be many reasons why it wasn't the shops fault, could have been defective parts, your car could be defective, you the vechile inproperly, Etc... Even your simple analogy can turn into a complex problem, and with the complexity of the study and so many different people and bussiness involved, it's not fair to blame one person.

I am not going to argue with you. Nothing you said - came from my typing on this forum. I am not even sure how you came to the conclusions you did based on what I typed. Melba - IS responsible. Melba was the one talking about how beautiful the results were. She put herself out to these researchers as the one who would end this question - if they just sent their samples. Would you feel better if I did bash these people? Is that what you want me and others to do? I won't do it. How in the world could the submitters be responsible - are they versed in DNA testing? No. I don't see anyone blaming the submitters. So, I don't know why you keep bringing this up.

IF Melba has what she says she has --- it is painfully clear to me she did not make her case. It is HER case to make to the scientific community - not those who sent the samples. Melba is the one making the claims -- not those who sent in the samples. You can think whatever you want to think about my opinion of Melba and her study - but I have actually been very silent - and have actually asked people on my blog to wait patiently for her to finish her work...... Which is NOT like me at all. I hoped like most others out there that this would be the end of this question. But - yet again - here we are. Maybe something will happen with this new round of "peer review" but I hold out little hope.

If I wanted to "smash this paper" - the obvious problems would be ALL OVER my blog - yet they are not. So, you are wrong. Heck, I don't even have the education in DNA to even get close to bashing her paper. But thank you for assuming I do. Now, I can speak to her "evidence collection" and "chain of evidence" - and it's nothing to brag about. Yet - I have remained silent for a VERY long time. Not quite the actions of someone who is trying to "smash her paper"......

My car analogy is just fine. Most of the people who sent in their samples have about as much knowledge of DNA and the testing of it - as I have about fixing the transmission of my vehicle.

Edited February 16, 2013 by Melissa

[Guest]

Geez, I take some time away and wouldn't you know it...all Hades breaks loose!

Ok, after plowing my way through over a dozen pages (and more than 20 yet to go), I'm going to assume the "downstream" pages are more of the same back and forth.

So, what have we got?

As I predicted some time ago:

1) Ketchum probably has DNA indicative of a new primate species.

2) Ketchum over-claimed her paper, which also had some technical issues.

3) "Legitimate" (translation: Skeptic-approved) journals didn't take it seriously from the get go and she had to go around them to publish.

4) Skeptics are having a field day screeching and throwing poo at the study, which they have no intention of actually reading, or attempting any scientific work to counter the claims of the study.

Have I missed anything?

The next step needs to be "naming and shaming" all the so-called "legitimate" journals and reviewers who failed their duty to honestly and ethically evaluate the paper in an impartial manner.

Edited February 16, 2013 by Mulder

[Guest]

^Yeah, missed quite a bit actually. Good Luck!

Edited February 16, 2013 by apehuman

[Xion Comrade]

Several people mention both in this threaf and elsewhere that the full length 'Matilda video' shows her waking up and walking away clearly, is 6 minutes long, shows a clear face shot, etc.

Who's word are we taking for this? It seems everyone has the same 'details' - where are they coming from?

When this whole thing(Erickson Project that is) was first nearing completion/really getting rolling(Some time ago) I recall someone both directly involved with the project in some way and very very well respected in the community(Can't remember who) mentioning that they had around 200 clips by that time in all(A year or more ago), in other words they are freaking loaded with material and not just from the Kentucky sight.

[Guest Check]

^^Xion

Right, and that's my understanding of the story as well. I'm just trying to find out who is standing behind it, stating it as a known fact because they were either on locatuon, saw the tapes, or otherwise have solid evidence it exists?

I just assumed for the past several months that this paper would publish alongside remarkable footage. It hasn't, of course, so now am trying to trace backwards to figure out who in fact has good first hand information that these videos and photographs exist at all.

[Guest]

Mulder, We have argued in the past, so let me start with, I’ll give you bigfoot exists one hundred percent. We just can’t keep enabling Dr. Ketchum.

[Guest BartloJays]

so you are saying that submitter's actually had bigfoot samples, and mk just failed proving they were bigfoot samples ? that doesn't work, she is not the only one worked on the project and clarifed the data. Or, your saying that all the samples were bad, the submitter's are either sadly mistaken, crazy, hoaxers, etc... and MK

was wrong becuase not one of the sample were real.sorry melissa, you keep trying to smash this paper and for some odd reason you want to blame her for every thing, she is not the only person involved with the project

your car analogy is comparing apples to atom bombs, coundn't be farther apart. to think it's "the shops fault" or" your fault" there could be many reasons why it wasn't the shops fault, could have been defective parts, your car could be defective, you cperate the vechile inproperly causing the failure, Etc... Even your simple analogy can turn into a complex problem, and with the complexity of the study and so many different people and bussiness involved, it's not fair to blame one person.

I'm sorry, but it 's not any of our jobs to prove what isn't a bigfoot with respect to her paper, it's her burden to prove to us (the world) through her paper, and on behalf of the submitter's... what is.

Besides some instances of denial, I commend the submitter's and all their work as this product or presentation, is not their fault.

Edited February 17, 2013 by BartloJays

[Guest]

Derek,

If you do not mind me asking- Are you and the OP satisfied with how the Dr. Ketchum data has been presented and is being excepted thus far?

I'm just very curious to hear from someone on the inside.

Thanks,

Gary

Well I'm not really on the inside. I've been in support of her since the beginning because I was very happy that someone put forth the effort to take on this task. We have been sitting back waiting for the release just like Carpenter, Paulides, Adrian and all the other submitters. I am disappointed that it didn't get published in a major Journal like Science or Nature, but none the less I'm glad it's finally out so qualified eyes can now see it. I was excited about what I was told the DNA showed, and I put myself on a crash course in genetics, but I didn't learn enough to be dangerous. It made my brain hurt.

Am I satisfied with the way it came out? That's a tough question. I'm just glad it did finally come out. It's been a very long five years, and It's really nice to think about other things and focus on our other research. I am told that there are some very qualified eyes looking at it right now, and I look very forward hearing what they have to say. It's really nice to that there are qualified people here looking into it as well. At the end of the day it will either stand on it's own legs, or fall flat. But I will say again, I'm grateful that someone stepped up and did it. I'm also hopeful that the Genomes can be looked into further. Hopefully something can be learned from them.

DR

[Guest]

So, basically what your saying is - if I take my car to a repair shop and they do horrible work - it's my fault and not the fault of the car repair shop? C'mon.. If you want to lay blame on the submitters that's your thing, not mine. I don't blame these people - it was and is up to Ketchum to prove her work - not those who submitted the samples.

In some cases this can be the case. Especially if one has never been in the position of having to know who is a good repair shop.....with never getting input from a previous car owner who used the facility.

[Guest]

Geez, I take some time away and wouldn't you know it...all Hades breaks loose!

Ok, after plowing my way through over a dozen pages (and more than 20 yet to go), I'm going to assume the "downstream" pages are more of the same back and forth.

So, what have we got?

As I predicted some time ago:

1) Ketchum probably has DNA indicative of a new primate species.

2) Ketchum over-claimed her paper, which also had some technical issues.

3) "Legitimate" (translation: Skeptic-approved) journals didn't take it seriously from the get go and she had to go around them to publish.

4) Skeptics are having a field day screeching and throwing poo at the study, which they have no intention of actually reading, or attempting any scientific work to counter the claims of the study.

Have I missed anything?

The next step needs to be "naming and shaming" all the so-called "legitimate" journals and reviewers who failed their duty to honestly and ethically evaluate the paper in an impartial manner.

We don't know her paper was actually submitted to any journal or that she encountered bias reviewers. She claims to have the paperwork to prove it, so she needs to show it, not just expect us to take her word for it.

[Guest Tyler H]

Throughout my efforts in this saga, I have had the pleasure of interaction with some very well-educated, very sharp scientists (geneticists, biologists, anthropologists, etc.)

One of them has provided me with this analysis that goes beyond my payscale, but does seem salient to my layman's mind. Hopefully it can be further addressed by some of the appropriately educated people here. This particular source of mine doesn't really "do" blogs, so is unlikely to be available for comment.

From a copy of a sequence file related to Sample 26, a preliminary analysis was performed using the BLAST (Basic Local Alignment Tool) at the National Center for Biotechnology Information (NCBI).

Here is what was found:

1) mostly human sequences returned

2) some bear sequences turn up as highly significant matches

3) probable sequencing errors (incomplete or poorly proofread/unconfirmed nucleotide sequences)

4) potential method- or system-specific artifacts that significantly undermine the interpretation of the data

A further look at one of the bear sequences, brain-derived neurotrophic factor (BDNF), provides a good illustration of the problems at hand. Only a partial sequence of the bear gene seems to be present (red type below). Oddly enough, there appears to be sequences for human BDNF immediately adjacent (blue type below) to it. This would appear to be a major artifact due to bear and human genomes present in the sample, with subsequent misinterpretation by the system software during the construction of a consensus sequence. There are potentially common sequencing artifacts (green type) that are flagged by the BLAST algorithm. Additionally, and not surprisingly, there appear to be insertions (orange type) and deletions (fuchsia type) that commonly occur in the method, suggesting a lack of quality control of the sequencing output. Finally, there are sequences which don't really match anything (black type). Because they occur as very short stretches they also appear to be artifactual, and, again, suggest poor quality control.

Such sequencing data would typically be viewed as incomplete and unfit for interpretation, let alone publication. Sure, we can say that there is bear and human associated with the sequence, but it will be difficult to claim that there is sequence from an unknown primate in the mix, especially if it aligns closely with human. The "human" sequence was analyzed further by aligning with gorilla, chimpanzee, and orangutan homologs to see if the sequenc might show characteristics of a non-human primate. The sequence did not display characteristics suggesting anything other than human.

>Sample 26 unknown BDNF

GTTACAGTGTTTCACAGAGAGAGGGCCGTGTTGGCAGGTGCAGAGCCCAGCTCCCCAGATGGAATCATCTTTTCCTTATTAATTTGCTGCGTGTTGCTTCGCATTTCTCGCAGTCGTTCCAAATGTGTTACAAACGACTACA

TGCTCTGGGTCCTGAATCCACGACTGCTGAGGACTTTGCAAGCTCCCTGGACAGATTGGGATCGAGTAATTCATCTCATTGGATCTGTTCTTCCATATACACAACACAAGTCAATGTTTGTTATGACTTTCTTGATCCTTATTT

ATAAGACAATACAAGAGGAAACCATGTGTGTATGTTTGAAATAGAAATGATACATTGCACAGATATAGTTCACCACGTTCTGGGATGGGTTGTCAGTGTTCAAATGGGGAGTCTGAAAGAGTAGGAACAGATGCTTTTTTTC

CTTAATGGCTCTTTCTCTAATTTAAAATCCTTCCATTTATTTCCCTAAGATTTAGTGATAACTTTAAACACTTTAACTAAATTACCCAGCGGCTTGGCAGCCATCACAGAGGCAAATCTTTTTAGAAATCCTAGCAATCTGTTAG

ATCATGGGTACTATGATATAAAATCTGCATGCTTCACATACAAAAATTAAATCAGTGCAATGGATACAAATGCATAATGCAAATGGCACCATTGACTTTCTAAATTTGGGCCAATTTATTCTCATTATTCCTAAGTAAACCTACT

TTGATTTTTTTTTTTAACAGTTATTTTATAATCAAATAGAGCCAGCCAGCCCTGCTTCATGGATCCTGATGTTGCTAGGATACATGGTTTGTACTTGATGAAAGTATATCACTTCAAAGGAGAAAACTTTCAAGTGTCCTAGAAT

ATGACACTGGGCTGTGCAATTGCTAAAACTAGTCAGGTTGGTCTTAAAGCAAGGAACACACGTATTTATAATAAAACACGTTTTCATGTTTGGTTTTACAGTGAAGAGAAAAAACCCAGAACCCCCAGATTTTATGTACTTTG

AAAATATATTTAAAAACATTAAAAATTCTATATTTAAAACATATATTATATGTTAATTAGTACACTTAAATAGAACTTGTATTTACATAGGCTTCTGATGCGGTTAAGTTTTAATGCCAATTTTTTTCAATAACACAATTATATAAA

TATACTAAAATACAATAAATATTTTTTTTTTGTTTTACATGGTGAATAATATCTTTACCATAGAGAAAACAAGGCCACAGACATTTACTTACATTTTCAATGGCAATCACCATAAAAAAGCAACAGGCCTGCTGGCATGCATGA

AAACACTTCTGCCACAAAGAGACCACAGCAAGACTTTAAAAAACAAAACACAACAAAACAAAAACTGAACAGCAACAGAGAAAGATTTTAACAAAATAAATCTTAGGTCAACATAAGCCACCAAGCATGTGACTGTGATGTA

TCCTATTGGGTAAGAGAGCCAGTGACCACGCAATTGCTCAGTGTCTCCTCCAGCGAGAACCTCTTAGCACAGTTAGATAATGTAGGCACTTAAAGCACGAGGTCCAAGCAACTTGATGCAGTCATTCCAGAGCCACCTCTG

AAAGGTCCTTCAGAGGCCTCCCTTCTGGAATGTCTCAAGTACCATTCCCCACCATCAACCAGAATATATATTGAAGGAATTCTTTCCCCATCCCTACTCCCTATGGGAACTAAAGAAAACAAAACAAAAACAAAACAAAACAA

CAAAACAAACATATACCCCTCCCATCCCCCATTCCCTAAGCCAGTAAAGCGATGACAACAGCACCTTGACATTGTTTTAATTCCAACGCTATCAGAAGTTAAAAGCAGTAAAACAGATAATAGTACTAACAAGAACGAAGATA

CTTACTGTCTAAAACGTAAATGGAATGTTTTGGTTCAAATTTTTTTTTTTTTTTTTTTTTTTTTGTCTGTTTTCTGAAAGAGGACAGTTTATTATCAATTCACAATTAAAGCAGCATGCAATTTATTATTATTATTTTTTTAAACTTTT

TTACGTTTTCAATTCTTGGCAACGGCAACAAACCACAACATTATCGAGGAATGTAATGCAGACTTTTTAGAGTTGTGCGCAAGATGACTGTTTCCCTTCTGGTCATGGATAGGTCCAATAAATAGATTGTAGAACCACTGTAC

TGTATAAACTTCATTTATACATGCAGTTCATAAAATTATTTTTTTCTTAACTGAATAATTTACCCTGTTATGTATATATACAAATAGATAATTTTTGTCTCAATATAATCTATACAACATAAATCCACTATCTTCCCCTTTTAATGGT

CAGTGTACATACACAGGAAGTGTCTATCCTTATGAATCGCCAGCCAATTCTCTTTTTGCTATCCATGGTAAGGGCCCGCACGTACGACTGGGTAGTTCGGCACTGGGAGTTCCAATGCCTTTTGTCTATGCCCCTGCAGCCC

TCCTTTGTGTAACCCATGGGATTGCACTTGGTCTCATAGAAGTACTGCTTCAGTTGGCCTTTCGATGACCCTCATAGACATGTTTGCAGCATCCAGGTAATTTTTGTATTCCTCAAGCAGAAAGAGAAGAGGAGGCTCCAAA

GGCACTTGACTACTGAGCATCACCCTGGAAGTATACAAGTCCGCGTCCTTATTGTTCTCCTCACTGGGCCGGACTTTCTGGTCCTCGTCCAGCAGCTCTTCTATCACGTGTTCAAAAGTGTCAGCCAAGGAAGTCAGGCCTC

TCGAACCTGCCTTGGGCCCATTCACGCTCTCCAGAGTCCCATGGGTCCGCACACCTGGGTAGGCCAAGCTGCCTTGTCCTCGGACGTTTGCTTCCTTCATGGGGGCAGCCTTCATGCAACCGAAGTATGAAATAACCATAG

TAAGGAAAAGGATGGTCATCACTCTTCTCACCTGGTGGAACTGTAGGGAGAAAGCAGAAAGAGGACACAGGACTTGTTAGGGCTTTCTTCTGCAGGGATGCAGTGTGGCCTTTTGGAATAGGCAGCTAGTGCTTCTTTCTG

TGCTTTTGAAGTTTTCTGGGAAGTCCCTTAACAGCACACCACAAAATTAATCTTTTCCTGTTTGCCAGAGAGCCATGTGGACCCCGTTCCAGAAACTGGCCATGTTCCAGAGCTACTATAAA

Red = Bear

Blue = primate

Green = artifactual

Orange = possible insertion (possible artifact)

Fuchsia = possible deletion (possible artifact)

Black = unknown (unidentifiable, possible artifact)

[Guest]

Gulp!!!! Seriously, that is worrisome. I don't know alot about this field, but she would have to have untouched blood and or saliva samples left to rerun this. Hair won't usually work. Is that the correct thinking if anyone wanted to do a rerun of the materials?

[Guest]

Well I'm not really on the inside. I've been in support of her since the beginning because I was very happy that someone put forth the effort to take on this task. We have been sitting back waiting for the release just like Carpenter, Paulides, Adrian and all the other submitters. I am disappointed that it didn't get published in a major Journal like Science or Nature, but none the less I'm glad it's finally out so qualified eyes can now see it. I was excited about what I was told the DNA showed, and I put myself on a crash course in genetics, but I didn't learn enough to be dangerous. It made my brain hurt.

Am I satisfied with the way it came out? That's a tough question. I'm just glad it did finally come out. It's been a very long five years, and It's really nice to think about other things and focus on our other research. I am told that there are some very qualified eyes looking at it right now, and I look very forward hearing what they have to say. It's really nice to that there are qualified people here looking into it as well. At the end of the day it will either stand on it's own legs, or fall flat. But I will say again, I'm grateful that someone stepped up and did it. I'm also hopeful that the Genomes can be looked into further. Hopefully something can be learned from them.

DR

Hey Derek,

Thanks for taking the time to respond. One last question, are you still bound by any legal mumbo jumbo?

I wish you the best in your research in the future.

[Guest Ishcabibble]

Melissa, I agree with everything you say regarding the submitters, and would even go a step further. Derek, you would be in a better position to talk about this, but if I was one of the submitters, and had taken great time, field work, and care in collecting the samples, I would be extremely upset with way they were apparently handled and presented by the authors. To the point of really regretting even submitting them in the first place.

None of this mess should be attributed to the submitters. This all rests squarely on the shoulders of MK and the rest of the authors.