The Ketchum Report (Continued)

[Guest]

Peer review is flawed, without a doubt. But it is infinitely better than not having anything. Having personally gone through this process many times, I know this. But if the science is good (and it just isn't with the MK paper - sorry), the authors can argue their point. In the end, it may not get it in- journals often reject papers on the fact it is too descriptive, no hypothesis, or just does not fit. And if it does not get in, you generally take it down one tier of journal status (ie try in a less prestigious journal) and try again. In this case the science is flawed, and it in no way substantiates the conclusion of a new Homo sapien species. I don't think it should have been published - period! It is unfortunate that it has been ridiculed by a bunch of grad students and others in the scientific community, but MK brought a lot of this on herself with the manuscript itself and the method of getting it out there. Yes, Bigfoot is a bit of a joke in the scientific community, but MK has just made it 10x worse. Again, THANKFULLY, this does not really appear to have gone mainstream.

I hate to say this, but I am going to anyway.

With the colossal failure of Melba's paper could she have just made things worse? Will the next Wally H be willing to provide unlimited funding for the next "sasquatch genome project"? Since her paper broke - I have been reading nothing but criticism and hearing flat out laughter from the scientific community. Will we now have more trouble than ever getting a scientist to analyze DNA samples?

I know Melba is all into the "protect the sasquatch people" - but could this paper and its outcome caused many in this community to say, "to heck with being no kill now - cause no one will believe me unless I bring them a body"... Is this where the community could be heading?

Before you say - no way.. I am already hearing rumblings.... So, this is not a step in a direction I was hoping for. I don't blame Melba - but I think this may be a side effect of the results of her work.

Edited February 27, 2013 by Melissa

[Guest Tyler H]

I was wrong when I said that my PhD source had made his last contribution on this topic.

He's a true scientist, and as such, you can't quell his curiosity, so he has continued to dabble with Melba's data. I think this most recent update may be as telling as any he has given, and can inform the efforts of others who want to follow down this path (I copied the fasta data from a pdf file, and it does not format the same here on the forum, so I had to do a lot of re-formatting - I think I may have messed up one letter) :

"Below is an example of what that looks like over the first 6900 nucleotides of the sequence provided. You really have to break it down into smaller segments to see it. So, I did this last week just to be a bit more thorough and validate my conclusions. When you start with a 6900 nucleotide segment, which was the first page of the document that I created from the sequence file, clearer homologies start to pop up. Breaking those down further into segments of several hundred nucleotides really brings clarity. You can see how segments of homologous contaminant genes got incorporated into the construction of the consensus. (Font changes added by Tyler Huggins). Basically, there was no monitoring of the output. I think the questions that should have been asked were just too complex for a contract lab to address on its own.

TGAGCTGACAAAGTGGAGAGGGCCTTGGACGAACCACCTAAGGAATGTTTCCAAACAGTAAACAGGATGAAGATGTAGGAGATGAGGAGTATGAAGAAAGA

ACCCTAACCCGAAACCTAACCCATAATCCCTAACCCCTAACCCTGAACCCGAACCCTAACCCCTAATCCTCGAACCCTAACCCTAACCCTAAACCTAACCACGTAATCCCTAACCCTAACCCT

AACCCTAAACCCTAACCCTAACCCCTAACCCCTAACCCTAACCCAAACCCTAACCCTAACCCTCAAACAAAACCCTAAGCCTCACCCTAACCCTGACCCTAACCCTAACCCT

AACCCCTAACCCTGAACCCTAACCCTAACCCTAAACCCTGAACCCCTTAAACCCTCTAAAAGGACCCTAAACCCTAAACCCTAACCCTAACCCTAACCCTAACTCCACTAGA

CCTCTAACCCTGAACCCTAACCCCTAACCCCTAACCCTAACCCAAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAAACCCTAACCCTTAAACCC

TAAACCCTAACCCCTAACCCTAAGACCCTAAACCCTAAACCCTGAACCCTAACCCTAACCCTAACCCTAACCCCTAAACCTCACTAACCCCGTAACCCTAAACCCTAAACCC

CCGTAACCCTAACACCCTAACCCCTAACCCTAACCACTAACCACTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCCTAATCCTAACCCTAAAACCCTAACC

CTAAAACCCTAACCCTAACCACTAAACCCTAACCCTAACCCTAAGCCTGATCCTGACCATTACCCTGACCCTAACCCTAACCCTAACCCTAACCATAACCCTAAACCTGAAC

CCTAACCCGAACCCTAAACCTGAACCCTAACCCGAACCCGAACCCGAACCCTAACCCTAACCCGAACCCAAACCCTAACCCTAACCCAAACCCTAACACGAACCCTAACCCT

AACCCGAACCAAACCCTAAACCCTAACCCTAACCCTAACCACCCCAAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCT

AACCCTAACCCTAACCCTAACCCCTAACCCTAACCCCTAACCCTGGGGAGAAGGATGGTGTCTGGTTCCAGGCTGCTCAGAGCCCCTGCCCCACAGGCTTTGTGAAGCACAC

GCCCACCAAGCTGCGTGCACCCGCCTACAGCTATGCTCCTGGCAGAGAACTGCTCCCCAGGGCCCCGCTACAGCGTGAACCCCAAGATACTGAGGACTGGCAAGGACCTCGG

CCCCGCCTACTCCATCCTGGAGCCTTTGTCTCACCAGCCCTGAAGTCAGCATTTCCATCCTGGACACCCCCTGACCCGACTTGGTCACCACCTGTGTTGGAGCCCAGAGGCC

CCACGCCTAGCACCCAGCCACTCCATTTCTGCCCGGACCAAGACCTTTCGAGTGGACAGCACCCGGTGACGAAGTTCAAGGCTCCGCAGTACACCATGGCAGCCCGGGTGGA

GCCCCCAGGGGACAAGACCCTCAAGCCAGGACCAGGAGCCCACAGTCCTGAGGCCTGGTGGAGCCGCTCTTCTCCCTGCCCACAGAGACTGGCGGAGCTGCTGGTCTCGGTC

CTGGAGCAGGGCTTGCCGCCCTCCCGCCGCGCCACCTGGCGCTATGCTGGCATCGCCTTCGAGGAGTCGGCCCCGGAGCCTCTGGACATGGACGTTGTACTCGAGTCGCTCA

AGTGCCTGTGCAACCTCGTGCTCAGCGTCAGGAAGATGCTGCCCTTTATCGGCACCTGGGGACCATTCTGCGGCACTGTGTGATGGTCGCTGCTGCTGGAGACCGCACAGAG

GAGTTCCACGGGTGTGCCACTGGGCGTGCTGATGCCGGCCCCCACCATGGCCACCACCCTCTGGCAGGCTCTGGCTTGGATCAGCTCCACTATATCCTGCAGAAAAAGCTTC

GGGCCAGCAGGTAGGACTCCCACGATGCCCAGCCCTTATTCCCCCATGTATCTACTCGCTCATACAACAGATGTTCATTGAGCGTCTTCCCTAGGCACACGTGACCGCGCGC

GCCACCGCCCCCGGGAGGCTGCAGAGCCGCCTGTGCTCACCGCAGTGCGCGGAGGTGCGCGGCTTCTCGGACAAGGACAAGAAGAAGTCTACCGCTTCGTGAAGGAGAACGA

GACGCTGTTTGCGCTGTGCTTCGTGCCCTTCGTGTGCTGGATCGTGTGTACTGTTCTGCGCCAGCAGCTCGAGCTCGGCCAGGACCTGTCGCGCACCTCCAAGACGACCACG

TCTGTGTACCCGGTGCCTCCTCTGATTCTGCACCTCGGTGCAGCCTCTGGCCTGGCTGCGCTCTGAGGAGCTCCCTGTGGCCACCGAGCCCTTGGAACGTGGCCAGTTCCGA

TGCTTCTCTTCACCCCAATTCTGCCCCTCCTGGTCCTCCTACCCAAGGACACTCAATCCAGGGCCACCCTCTGCTCCAGGGCCATGCCTGGGCGTCAGCCCCAGTACAAGGG

GCAGGTGAACCTGCACGTGTTTGAGGACTGGTGTGGAGGCGCTGTGGGCCATCTGAGGAGAAACCTGCACTTCCCGCTGTTCCCTCATGTGAGTGCTGGGGCTTTGAGCTGC

TGCACAAGCAGGACGACCGAGGCTCAGACCACGTGGAAGTGGGCGTGAGTGCGCCCCGAGCTCTGCCGGCCACTGCGCCTGGCCTGGCGCCAGGATGTGATGGTACACTTCA

TCGTGCCAGGTGCGCATCTACAAGTCAGACTTTGACCGAGTTGGAGGCATGAACACTGAGGAGTTCCGTGACCAGTGGGGGGGCGAGGACTGGGAGCTCCTGGACAGGTGAC

CACATGCAGGACGGTAACTTCCTGCTGTCGGCCCTGCAGCCCGAGGCCGGCGTGTGCTCCCTGGCGCTGCCCTCTGACCTGCAGCTGGACCGCCGGGCCACAGAGGGGCCGG

ACGCTGAGCGGCTGCGAGCAGCCCGCGTCCAGATTTGATGACATTGACCTGCCCTCAGCAGTCAAGTACCTCATGGCCTCAGACCCCAACCTGCAGGTGCTGGGAGCAGCCT

ACATCCAGCACAAGTGCTACAGTGATCCAGCAGCCAAGAAGCAGGTGACCCCCCGCACACACCTGCGTCACCTCCCTACCCCCACATATACCTCATCACCTCCGTACACCCG

CACACACCTGCGTCCCCCCAGCCGACGTGCTGGTCAACATCATAGCTGTGCTCAACAACCTGGTGGTGGCCAGTCCCATTGCCGCCCGAGACTTGCTCTACTTTGACGGAGG

TGGCCACCCACAGCCTTGGCCCAGACCCACTGCCAGGGGCTGCCCCTGCTCACCCCCTGCTGTGATGGCCTGTGAGGCCCAGGAAGTTCCCAGGCAGCTCCGCACCACGGAG

CCGGGCCTCCAGAGCAGCAGGGTCACCAGGTGGCGGTGCTGGCGCAGCAGGCGGAGCGCGGGGTGCGATGAAGATGGGTCTGCGCGTGAGCTCCAGCAGCCGGCACAGGCCC

TCCCTGCGGGGGCGGGACCGTTAGGGGGGGCCCACCCAACCCCGCGCGGGACCCACCGGAAGCTGTGGCTGCACCAGGCCCGGCCCAGGAAGGCGTCCGACAGCACCACGAT

GAGGCGCCGGCAGCGGCTCAGATTCACCAGGAGGTCCGCCGAGGGCTCTGCGGGAACCGGGCGTCGGCGGGTCCTTGGCCTTGCGGGGCACCAGGCGCCGCTGCAGCCTGAC

CATCTTGATGGCGTCCAGGCGGATCTCCACAAGGTTGCTGAAGAGCGCGAGCAGCGGGGCGAGCGGGAAGGCGGCCACAAAGATGGTGGTGAAGCCGTACTGGATCACTGAC

TGAGGGGCTGTCTGTTCTTTATTTGCAGAGGTATTGTGGCCAGTATTTTGGTTTTCTTATGTTTTGGAGTCACACAAGCTAAAGACGGGCCGTTTTCCAGACCTCATCCAGG

TACCGAGACTGGTGGATGTGCACGATCGTGAGCGTCATGTTCGAGTTCCTCGAGTACAGCCTGGAGCACCAGCTGCCCAACTTCAGCGAGTGCTGGTGGGACCACGTAGGTG

CCCAGTGGATCATGGACGTGCTTGTCTGCAACGGGCTGGGCATCTACTGCGGCATGAAGACCCTCGAGTGGCTGTCTCTGAAGACGTACAAGTGGCAGGGCCTCTGGAACAT

TCCAACCTACAAGTGCGTCTTCCAGTTCACGCCCTACAGCTGGGTCCGCTTCGAGTGGAAGCCCGCCTCCAGCCTGCGCCGCTGGCTGGCCGTGTGTGGCATCATCCTGGTG

GTAAGGTGGCTGCCCCCGGAGCACTACCTGGTCCTCCTGCGGCTGGTGTTCTTCGTGAACGTGGGCGGCGTGGCCATGCGGGAGATCTACGACTTCATGGATGACCCGTGAG

GGCGCCTCAACCTCCCAAAGTGCCTGGCCTTCATTTTTATTTTTGAACTTACCTGCCTCACCTCGTTATGTCTTTATCTTATTTTTAAACTTACTCAGTTCACATACTAAAA

TACAAAAACAAAAATTAGCTGGGCGTGGTGGTGCCTGCCTGTAGTCCCAGCTACTCAGGAGGCTGAGGCAAGGTAATCACTTGAACCCAGGGGATGCCATAGCTGCGGGCAA

GGTCCTGTGCCTGCCGGGACTCCACAGTGCGCGCAGCCAGATCACACTTGTTCCCCACCAGCACCATGGGCACGTCATCTGCTGCCTCAGGAGTGTCCAGTGGGTGCCCAGG

CTACCTGTGGACAGTTTGCCAGTGATGTCCAGTTTGTCCTGAGGCGGACAGGGCCCAGCCGGGTCGCGCTGCCCAGGGACAGATCAGCCGCTGTCACACGCACAGTGGGTCC

GGAGCAGCGCAGTGTGCGGTGGGCAGTGGCTGCCCTGCGCCTGGAGGCTCACCTTCACCAGGACCAGGCTCTTCTCCTTGGGCCTCCCAGCTGACAGGTCCTGCCCAAAGCC

CAGGTAGATGGTTCATCGGCGCCGTGCTCGCGGGGAATGCGCTCGTGTGCGTCAGCGTGGCGGCCGAGCGCGCCCTGCAGACGCCCACCAACTACTTCATCGTGAGCCTGGC

CCGCGACCCAGCCGTGTGCCGCCTGGAGGACCGCGACTACGTCGTCTACTCGTCCGTGTGCTCCTTCTTCCTGCCCTGCCCGCTCATGCTGCTGCTCTACTGGTCAGCGCGG

TCACCTGGCTGGGCTACGTCAACAGCGCCCTCAACCCCCTCATCTACACCGTCTTCAACGCCGAGTTCCGCGCCGTCTTCCGCAAGGCCACCTGAATGAGGCACTGCAATGG

CCTGCCCGCGTAGCGAATGCTTCTCTTCCAGTCCTTACTGCTGGCTCTTCCTGCCATGGCTTCAAACTCGGTCGGACTGTACCAGTTCTCCCCCCCGCCGCTACAGCGGCCG

CGGCCGCCACCGCCGCCGCCTCGGCCAGGCCCAGCTGCTTGGCGGCCGAGTCCGAGTCCTCCATCCGGACTCCGCCGAGCCGAGCCACCCCTGGACGTGCTGCAGGAGGCCC

CCTGGGAAGTGGAAGGGCTGGCGTCTGCCCCAGGTCGCAAGAGGAACAGATTAAAAATGCTATCGATAAACTTTTTGTGTTGTTTGGAGTAGAAATATTAAAGAAGATTCCG

GGCCGTGTATCCACAGAAGTACTGCTCTCTGAGCGGAAGTGCTGGAGGATGCGGGCCAGGGAGCCACTGCTGGCCAGGTCGGCCAGGGCCCCGGGACAGCTGGGAATCAGGA

GGGCATGGACTCAACACACCACACCCAATCCAGAAGGCTCTGGGGGCCTCTGTCCTACCAGGGGAAGGACACAGCCCCGCCCACCCTGCCTGCCGGAGAGCACTTACAGTAC

AGGAAGTGGCTCCGTGCCCCCCGCCTGGCCCCCAGGTATTATTTTTTCCGGACCAGGAAGGCCACACCGAGAATCAGGGCTATGGCTGCCACGGCTCTCACAGGACAAGACA

CAAAAAGTTACAACTTCTTAAAACTCTTCAAAACAAAAAATATAATTCTGTAAGCAGCAGCAGCAGCTTCCAAGGTTCAGATGTGGTGGGAGAGGGCAGCTCCCAGGAACAA

CCGTGAACTGCCCCTCCCCCCACACCCTCACCAATGCGGCCTGCGTCCTGAAGCTGGATCTTCAGCATTTCCATGGGCGTGGTCACGATCACCTGGCAGGTGCCAGCCCCAC

AGCCCGCCAGCATCTCCTTAACCAGTCTCGTTCGCGGGCTGCGGCTTCCTCGGCGTCTACCACATCGGCGTGGCCTCCTGCCTCCGCGAGCACGCGCCCTTCCTGGTGGCCA

ACGCCACGCACATCTACGGCGCCTCGGCCGGGGCGCTCACGGCCACGGCGCTGGTCACCGGAGCCTGCCTGGGTGAGCGGGGCCGGGCGGAGGCCGGACGGGGGGGACATCC

GGTGGATGAAGGAGCAGACGGGTAGCATCTGCCAGTACCTGGTGATGCGTGCCAAGAGGAAGCTGGGAAGCCACCTGCCCTCCCGGTGAGCCGGATGCGTAACAGCCTCTCG

CTAGGGGACGCGCTGGCCAAGTGGGAGGAATGCCAGCGCCAGCTGCTCCTGGGCCTCTTCTGCACCAACGTGGCCTTCCCGATCTCCTGACCTTGTGATCTGCCTGCCTTGG

CCCCCCAAAGTGCTGGGATTACAGGCGTGAGCCACCGCGCCTGGCCCTGTGTCCCCTCCTATCCGTCCTGGCCGTCATGGCGGTGGGTATCTGGACGCTGGCCCTCAAGAGT

GACTACATCAGCTTGCTGGCCTCGGGCACCTACCTGGCCACAGCCTACATCGCTG

Sample 26

Nucleotides 1-6887

Blue = human

Red = bear

Black = unknown (non-homologous)"

^^Tyler....what a cryptic post....

Wild Turkey Federation?

Just had to have some fun, Cotter... this all gets so heavy at times! lol

Edited March 1, 2013 by Tyler H
to remove inflammatory name

[bipedalist]

"The giant panda's taxonomy (subfamily Ailuropodinae) has long been debated. Its original classification by Armand David in 1869 was within the bear genus Ursus, but in 1870, it was reclassified by Alphonse Milne-Edwards to the raccoon family. In recent studies, the majority of DNA analyses suggest the giant panda has a much closer relationship to other bears and should be considered a member of the family Ursidae." - http://en.wikipedia.org/wiki/Ursidae

I've seen some heavyweight bipedal raccoons around my ranch that made me an offer I couldn't refuse....... you might be on to something.

[Cotter]

^LOL

I get it, I popped in at the right moment.

I can honestly say I was hoping you were going to be wrong about something else.

Question - regarding the red vs. blue vs. black above, can one just assign percentages to the colors and say, for example, the sample tested above was 30% bear, 40% human, and 30% contamination? (I just pulled those numbers, I didn't actually calculate them).

The reason I ask, is, in my mind, if you started with bear, and contaminated it with human and 'other', shouldn't it come back as 90 something percent bear?

My ignorance about DNA is shining brightly, you may want some sunglasses.

[Guest]

Tyler,

Is that the code from the Sample you had?

[Guest J Sasq Doe]

He's a true scientist

Ah yes, and he/she shall remain nameless, hahaha.

Edited March 1, 2013 by AaronD
to remove inflammatory ramblings

[Guest Tyler H]

This is data from my source's efforts on sample 26 - Justin's sample in Ketchum's study.

Cotter - not sure about your question - hopefully RR will answer.

Ah yes, and he/she shall remain nameless, hahaha. You are quite the funny guy.

Interesting way you chose to phrase that. It makes sense in light of the fact that you're goading the villagers, supplying pitchforks and torches, trying to rally them to storm the castle, and get Dr. Ketchum's head on a pike on your behalf.

All this because you made a play for the brass ring she has in her grasp, but you were left "bear-handed".

Man, all the evidence just bounces right off, doesn't it? Everyone that knows what they are talking about, objectively explains what is going on here, and the die-hard Melba lovers just keep resisting.

Maybe this will be language that resonates better with you J Sasq Doe: "We are Borg. Resistance is futile."

[bipedalist]

J Sasq Doe what you got leveraged in all this?

[Guest J Sasq Doe]

I hate to say this, but I am going to anyway.

Oh, imagine my shock.

With the colossal failure of Melba's paper

Failure? You mean an acknowledged scientific expert has obtained the data from Dr. Ketchum's study, tried to replicate the results, and could not do so, in mere days? Please show me the link where this is referenced.

Before you say - no way.. I am already hearing rumblings.... So, this is not a step in a direction I was hoping for.

Alleged rumblings don't carry any weight.

[Guest Tyler H]

Melissa, on 27 February 2013 - 03:19 PM, said:

Before you say - no way.. I am already hearing rumblings.... So, this is not a step in a direction I was hoping for.

Alleged rumblings don't carry any weight.

If the rumblings are that people who used to be anti-kill are now turning pro-kill... then YES, they do carry weight.

Or do you need to wait a few years to see these changes of opinions compiled and then published in a paper that flunked multiple peer reviews, before you will believe them?

Edited February 27, 2013 by Tyler H

[Guest J Sasq Doe]

J Sasq Doe what you got leveraged in all this?

Not a single thing. I just see these constant attacks by Ketchum's competitors, but no one has had access to the data to try to replicate, or fail at replicating, her results. Until then it's just character assasination, innuendo, and petty sniping.

It should be all about the data. And until the data is released, it's all just petty sniping.

If the rumblings are that people who used to be anti-kill are now turning pro-kill... then YES, they do carry weight.

Or do you need to wait a few years to see these changes of opinions compiled and then published in a paper that flunked multiple peer reviews, before you will believe them?

I would guess that I don't know the 2 or 3 people you and your colleague Melissa may be talking about. But that's just my guess.

[Guest]

Just when things calm down, a new batch of Melba apologists.

[Guest]

Tyler,

Is that the code from the Sample you had?

this is the sequence that MK published. I just aligned it to my own MK sequence file, and it is 100%.

Question - regarding the red vs. blue vs. black above, can one just assign percentages to the colors and say, for example, the sample tested above was 30% bear, 40% human, and 30% contamination? (I just pulled those numbers, I didn't actually calculate them).

The reason I ask, is, in my mind, if you started with bear, and contaminated it with human and 'other', shouldn't it come back as 90 something percent bear?

If all the samples were of similar quality - maybe. The tissue sample was clearly sitting out in the open for some period of time and then presumably contaminated with human at the time of collection. The "bear" may have been somewhat degraded by the time the "human" was introduced. In the generation of the contig, they are looking for regions of homology at the ends, then linking them up. This process is not well described in the paper. The raw data should have more quantitative information on how many reads any particular sequence had, but that data has not been made available. Again all of the regions of homology are small, with no region of more than one sequence read equivalent (ie 50-150bp). I too suspect the error came in on the assembly of the fragments.

[Guest]

Mistake post. Sorry.

Edited February 28, 2013 by Melissa

[Guest]

Alleged rumblings don't carry any weight.

Well, then during the next phone call (of which I have had many far more than 2 or 3) I will make sure to say, "J Sasq Doe" doesn't think you will do it.

Does that make you feel better? I have had people email and call me to discuss their decision to go - pro kill - because of the outcome of this paper. I don't care if you believe me or not - but it is happening. I am not pro-kill myself but I understand their reasoning - and I am not their mother. Frankly I don't blame them for their frustration and desire to end this mystery.. But, I can't do it myself. I won't bad mouth them though. This is a very personal decision each one of us is going to have to make.

We can either discuss it - or not. No sweat off my back. But, just because YOU don't have proof - that doesn't mean it isn't being talked about.

It should be all about the data. And until the data is released, it's all just petty sniping.

I think Ridgerunner, theagenes and GenesRus have done a fantastic job discussing the data that Melba has disclosed. But, apparently - others- outside this community are wondering why she didnt release the full genomic sequences.. It's not a bad question. If she has them, why not share them.

You're comments are just as snarky as anyone elses. But, you are entitled to your opinion - just as I am entitled to mine.

Thank you Tyler,

It is true - and it is really taking up a lot of my thoughts lately.. what I wonder is - for how many people - was this paper and its outcome the final straw??

Edited February 28, 2013 by Melissa