Is the US government actively trying to make the Sasquatch race extinct?

[SWWASAS]

You bring up a valid comparison.     Science is the new Church.   A biologist at the University of Victoria just got fired from her job for spreading the heresy that data shows there are more polar bears now than there were 50 years ago.  How dare she defy the gospel of Climate Change with facts.   Quietly newspapers are suggesting that the polar bear be replaced by something else as a symbol for the dire effects of Climate Change.   

 

This is how things are done in the Church of Science:     https://youtu.be/8455KEDitpU  

[Huntster]

It's true. The number of polar bears has never been greater in recorded human history.

[Twist]

Was man previously it’s most deadly predator and now we protect it?   

[guyzonthropus]

Or maybe it's just a matter of our means of counting them has improved (or gotten a whole lot worse and we're counting some multiple times...)I

 

In regards to finding a body, and having it taken by authorities to prove they are in on it, well I d suggest that even if they don't take the body that there s still plenty of reason to think the government has known for a good long while...since it you can get one, it's pretty much a given that they did long ago and said nothing of it to the public! 

[georgerm]

On 10/21/2019 at 2:55 PM, SWWASAS said:

I just occurred to me that to prove the government is part of a coverup takes the same thing that it takes to prove existence.         That thing is a bigfoot body.      Get one and if it if is taken away you have proven that the government is part of a coverup.    If you get the body and get it to the correct scientists without government intervention at any point,   then there is no government coverup.   Even that has no guarantees,   since the scientists could be silenced.   Sadly there are enough anecdotal stories of bodies being hauled off by government entities,   my guess it that is the normal outcome for anyone who gets a body.    Because of that danger, anyone who has a body, bones, or parts that could yield definitive morphology or DNA best treat it like a secret and avoid electronic communication of all kinds.   

 

 

This seems to be the case. I wish we could find a military guy that was present at the Mt. Saint Helens bigfoot cover up. The whole story is strange. 

7 hours ago, guyzonthropus said:

Or maybe it's just a matter of our means of counting them has improved (or gotten a whole lot worse and we're counting some multiple times...)I

 

In regards to finding a body, and having it taken by authorities to prove they are in on it, well I d suggest that even if they don't take the body that there s still plenty of reason to think the government has known for a good long while...since it you can get one, it's pretty much a given that they did long ago and said nothing of it to the public! 

 

Agree, and is there any proof?  

 

[hiflier]

36 minutes ago, georgerm said:

This seems to be the case. I wish we could find a military guy that was present at the Mt. Saint Helens bigfoot cover up. The whole story is strange.

 

Are you kidding me? This whole subject is strange  

[guyzonthropus]

Hiflier I really doubt there would be a whole forum devoted to anything THAT strange! 

Lol

 

But this is more mainstream that a lot of the stuff out there! 

[hiflier]

By comparison I will have to agree  Unless the nests in the Olympic Peninsula were made by Unicorns even though there was no apparent Unicorn DNA noted in the samples  Dr. Ketchum was a geneticist who dealt with thoroughbred horses however so maybe, just maybe.......NAAAAAAH!

[starchunk]

1 hour ago, hiflier said:

By comparison I will have to agree  Unless the nests in the Olympic Peninsula were made by Unicorns even though there was no apparent Unicorn DNA noted in the samples  Dr. Ketchum was a geneticist who dealt with thoroughbred horses however so maybe, just maybe.......NAAAAAAH!

 

Arent we at a point that anything to do with Melba Ketchum is just Comedy fodder

[hiflier]

I was joking of course. To tell you the truth I would like to get a professional's evaluation of this raw data:

 

TCACTCCACCCCCACAGCCATCCCCCAGCTGGGGCTGGCTGCCAACCAGACAGGAGCCCGGTGCCTGGAGGTGTCCATCTCTGACGGGCTCTTCCTCAGCCTGGGGCTGGTGAGCTTGGTGGAGAACGCGCTGGTGGTGGCCACCATCGCCAAGAACCGGAACCTGCACTCACCCATGTACTGCTTCATCTGCTGCCTGGCCTTGTCGGACCTGCTGGTGAGCGGGAGCAACGTGCTGGAGACGGCCGTCATCCTCCTGCTGGAGGCCGGTGCACTGGTGGCCCGGGCTGCGGTGCTGCAGCAGCTGGACAATGTCATTGACGTGATCACCTGCAGCTCCATGCTGTCCAGCCTCTGCTTCCTGGGCGCCATCGCCGTGGACCGCTACATCTCCATCTTCTACGCACTGCGCTACCACAGCATCGTGACCCTGCCGCGGGCGCGGCGAGCCGTTGCGGCCATCTGGGTGGCCAGTGTCGTCTTCAGCACGCTCTTCATCGCCTACTACGACCACGTGGCCGTCCTGCTGTGCCTCGTGGTCTTCTTCCTGGCTATGCTGGTGCTCATGGCCGTGCTGTACGTCCACATGCTGGCCCGGGCCTGCCAGCACGCCCAGGGCATCGCCCGGCTCCACAAGAGGCAGCGCCCGGTCCACCAGGGCTTTGGCCTTAAAGGCGCTGTCACCCTCACCATCCTGCTGGGCATTTTCTTCCTCTGCTGGGGCCCCTTCTTCCTGCATCTCACACTCATCGTCCTCTGCCCCGAGCACCCCACGTGCGGCTGCATCTTCAAGAACTTCAACCTCTTTCTCGCCCTCATCATCTGC

 

http://www.sasquatchgenomeproject.org/sasquatch_genome_project_003.htm

[Huntster]

20 hours ago, Twist said:

Was man previously it’s most deadly predator and now we protect it?  

 

Their only predators are orcas and man, both of whom are not common in the Arctic Ocean, especially prior to the 20th Century. They became nearly completely protected worldwide by the mid-1970's, and orca numbers worldwide were down by that time too because of whaling (they also became almost completely protected). The only legal polar bear hunting is in Canada, where their densities are highest, and the harvest is very low. A polar bear hunt will cost you > $60K there.

 

Now polar bear numbers are higher than ever, but like usual, preservationalists are never satisfied. Any talk of limited harvest to keep populations at a scientific ideal is attacked rabidly. And of course, they now have this climate change silliness to use to broadcast their stupidity.

 

Ideally, they'd visit Barrow, drive out to the whale boneyard, get out if their vehicle to take pictures, and end up as hor d'oeuvres.........

 

1 hour ago, starchunk said:

Arent we at a point that anything to do with Melba Ketchum is just Comedy fodder

 

Only for the Clown Corps. Her study fits quite well with Sykes Zana study.

[hiflier]

9 minutes ago, Huntster said:

Only for the Clown Corps. Her study fits quite well with Sykes Zana study.

 

There is raw data. RAW DATA. It came from twelve unconnected, independent labs in a double-blind study and that study is what produced the raw data.

 

Dr. Melba Ketchum interpreted that raw data. She got slammed and to this day still gets slammed because she tainted her interpretation of the raw data through her own personal belief system.

 

Personally I don't care about what she said or even says today. I stay with the science and the science is in the raw data regardless of anyone's personal spin on it. I would like more independent experts to look at the data. Now I'm sure that that has happened but I am also sure that the PUBLIC summaries of any experts is weight against career choices but I STILL would like to find someone who would look ALL of the raw data who knows what they're doing.  

[Huntster]

3 minutes ago, hiflier said:

......Dr. Melba Ketchum interpreted that raw data. She got slammed and to this day still gets slammed because she tainted her interpretation of the raw data through her own personal belief system.....

 

I agree 110%. Moreover, had her study, interpretation, and behavior been absolutely perfect, she'd still get slammed. That's just the way it is and the way it's going to be.

[hiflier]

19 minutes ago, Huntster said:

Moreover, had her study, interpretation, and behavior been absolutely perfect, she'd still get slammed. That's just the way it is and the way it's going to be.

 

Bold statement but since what she did is held up as a smoke screen to distract from the raw science her shenanigans will always be spotlighted at center stage to discourage anyone from doing an in-depth study of the SCIENTIFIC results.

 

Following close on the heels of that argument is the fact that as far as I know there has been no raw data provided for the e-DNA nest soil sample results. So we are to just take the word of Dr. Meldrum and Dr. Disotell on those results? Without a white paper? With the Sasquatch Genome Project we have a TON of raw data. As far as raw data from the Olympic Peninsula nest samples (only 5?) we have.........nothing. And I guess we're simply supposed to accept that? No mtDNA even? No word about who was filtered out from the DNA equation? The samples had Human DNA so why don't I hear people screaming "contaminated? on that and slamming those results? 

Edited October 23, 2019 by hiflier

[SWWASAS]

I raised the contaminated issue after seeing some pictures and got shouted down by proponents who were involved in the project.     Show me a picture of the "nest" or anything else being searched by individuals dressed in street clothes rather than clean room suits without masks and I will raise the contamination issue.   Oh throw in another picture of someone laying in the nest to give us an  idea of size then tell me it was a serious study.      DNA seems to be the darling method of proving existence but it is being misused at the field level.   If I am seeing this stuff,   the scientists we hope to involve in the search are too.    We have to do better to for them to have any idea we know what we are doing and get their attention.   

 

Before those involved get too angry notice I used the word "we".